Mutagenetix > Incidental Mutation

Incidental Mutation 'R4758:Rasa1'

358356

Institutional Source

Beutler Lab

Gene Symbol

Rasa1

Ensembl Gene

ENSMUSG00000021549

Gene Name

RAS p21 protein activator 1

Synonyms

p120-rasGAP, Gap

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4758 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85214780-85289130 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85234448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 446 (D446E)

Ref Sequence

ENSEMBL: ENSMUSP00000105179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109552]

AlphaFold

E9PYG6

Predicted Effect

probably benign
Transcript: ENSMUST00000109552
AA Change: D446E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: D446E

Domain	Start	End	E-Value	Type
low complexity region	3	32	N/A	INTRINSIC
low complexity region	37	106	N/A	INTRINSIC
low complexity region	119	142	N/A	INTRINSIC
SH2	170	253	9.44e-29	SMART
SH3	273	331	1.7e-10	SMART
SH2	340	423	7.44e-27	SMART
PH	466	570	5.11e-20	SMART
C2	586	680	6.9e-10	SMART
RasGAP	689	1035	2.77e-156	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141879

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153231

Predicted Effect

probably benign
Transcript: ENSMUST00000223598

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	A	3: 36,073,605	Y119N	probably damaging	Het
Actn2	T	A	13: 12,288,586	K443*	probably null	Het
Adgrb2	A	G	4: 130,009,350	N581S	probably damaging	Het
Alb	A	T	5: 90,468,593	H319L	probably benign	Het
Aox2	A	G	1: 58,332,582	I802V	probably benign	Het
Arhgap45	G	A	10: 80,030,293	G995E	probably benign	Het
BC005561	A	C	5: 104,520,399	E929A	possibly damaging	Het
Capn12	A	C	7: 28,892,723	T689P	possibly damaging	Het
Cars	T	C	7: 143,571,567	S312G	probably benign	Het
Cast	T	A	13: 74,739,880	D216V	possibly damaging	Het
Ccdc13	C	T	9: 121,833,734	E72K	possibly damaging	Het
Cd300lg	G	T	11: 102,053,591		probably null	Het
Cep41	A	G	6: 30,671,369		probably benign	Het
Chrna3	A	G	9: 55,022,276	Y93H	probably damaging	Het
Cic	A	G	7: 25,292,211	R1309G	possibly damaging	Het
Clcnkb	A	G	4: 141,407,849	V526A	probably benign	Het
Clec4a1	G	T	6: 122,933,866	V227F	probably damaging	Het
Cpa5	C	A	6: 30,615,160	H99N	possibly damaging	Het
Crem	C	A	18: 3,327,527	C4F	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Decr2	C	A	17: 26,088,940	E46D	probably damaging	Het
Dlg1	G	A	16: 31,791,752	V284I	possibly damaging	Het
Dnah3	T	C	7: 120,079,406	E360G	probably benign	Het
Dnajc1	A	T	2: 18,308,946	Y121*	probably null	Het
Dnajc13	A	G	9: 104,172,574	F1783L	probably damaging	Het
Eps8l2	T	A	7: 141,360,373	D505E	probably damaging	Het
Eral1	G	A	11: 78,075,599	T251I	probably benign	Het
Eya3	T	C	4: 132,694,885		probably null	Het
Fam120a	G	A	13: 48,880,857	T1093I	probably benign	Het
Fbn2	C	T	18: 58,026,386	A2424T	probably benign	Het
Git2	G	A	5: 114,730,351	T256M	probably damaging	Het
Gm884	A	G	11: 103,614,464	V2226A	possibly damaging	Het
Gm9805	A	T	17: 22,689,871	Y34F	probably benign	Het
Itgb7	T	G	15: 102,216,207	T792P	probably benign	Het
Jakmip1	T	A	5: 37,128,622	I665N	probably damaging	Het
Kcnt2	T	C	1: 140,518,897	Y677H	probably damaging	Het
Klhdc4	G	A	8: 121,798,044	P382S	probably benign	Het
Knl1	TCC	TC	2: 119,071,732		probably null	Het
Lamb3	T	A	1: 193,339,961	M1039K	possibly damaging	Het
Lipm	A	T	19: 34,101,170	M1L	possibly damaging	Het
Magi3	T	A	3: 104,015,321	D1360V	probably benign	Het
Mier2	C	A	10: 79,550,348	C23F	probably damaging	Het
Myo1h	C	T	5: 114,349,582	R616C	probably damaging	Het
Nars2	A	G	7: 96,973,528	D187G	probably damaging	Het
Nbea	T	C	3: 56,005,403	M988V	probably benign	Het
Nlrc5	C	A	8: 94,512,328	Q1465K	possibly damaging	Het
Nlrp4e	T	C	7: 23,320,618	F177L	probably benign	Het
Oas1a	A	G	5: 120,907,338	F47L	probably damaging	Het
Oas1f	A	G	5: 120,847,480	E30G	probably damaging	Het
Obscn	A	T	11: 59,003,363	M6689K	unknown	Het
Obscn	A	T	11: 59,135,917	D153E	probably damaging	Het
Olfr605	A	C	7: 103,442,869	C85G	probably damaging	Het
Osmr	A	T	15: 6,852,555	I36K	probably benign	Het
Pcf11	A	T	7: 92,661,175	F535Y	probably damaging	Het
Pde2a	C	T	7: 101,511,499	R886C	probably damaging	Het
Pik3ca	T	A	3: 32,437,978	C242S	probably benign	Het
Pikfyve	T	A	1: 65,272,515	D1925E	possibly damaging	Het
Plekhm2	A	T	4: 141,642,005	Y123N	possibly damaging	Het
Pomt2	A	T	12: 87,122,878	V406D	probably damaging	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prdm10	A	T	9: 31,362,412	T985S	probably benign	Het
Proc	T	A	18: 32,123,810	Y268F	probably damaging	Het
Prrc1	C	T	18: 57,384,248	T365M	probably damaging	Het
Ribc2	T	A	15: 85,141,666	L281Q	probably damaging	Het
Runx1t1	A	G	4: 13,865,907	D385G	probably damaging	Het
Sdk2	A	G	11: 113,827,054	S1495P	possibly damaging	Het
Slc15a3	G	T	19: 10,854,362		probably null	Het
Slc43a3	A	G	2: 84,944,525	N149S	probably damaging	Het
Spata5	T	A	3: 37,433,236	S416T	probably benign	Het
Specc1l	A	G	10: 75,246,348	Q543R	probably damaging	Het
Spef1	T	C	2: 131,172,741		probably null	Het
Spns1	A	T	7: 126,370,794	F478Y	probably damaging	Het
Srebf2	T	C	15: 82,196,169	V821A	probably benign	Het
Stac3	A	G	10: 127,503,345	M108V	possibly damaging	Het
Stradb	A	G	1: 58,988,571	T87A	probably benign	Het
Stxbp5l	A	T	16: 37,134,230	M906K	probably benign	Het
Tex14	T	C	11: 87,514,485	V741A	probably benign	Het
Tpo	C	A	12: 30,075,871	G830C	probably damaging	Het
Unc79	T	A	12: 103,161,821	C2308*	probably null	Het
Vmn1r205	T	C	13: 22,592,846	T29A	possibly damaging	Het
Vmn1r69	G	A	7: 10,580,546	T7I	probably benign	Het
Vmn2r27	T	G	6: 124,231,637	T50P	possibly damaging	Het
Wdr83	A	G	8: 85,075,238	Y302H	probably benign	Het
Xirp2	A	T	2: 67,516,535	E3040V	probably damaging	Het
Zfp629	C	A	7: 127,610,586	G684W	probably damaging	Het

Other mutations in Rasa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Rasa1	APN	13	85288429	missense	probably benign	0.02
IGL01396:Rasa1	APN	13	85258442	missense	probably benign	0.10
IGL01670:Rasa1	APN	13	85225490	missense	probably damaging	0.97
IGL02095:Rasa1	APN	13	85216155	missense	probably benign	0.10
IGL02822:Rasa1	APN	13	85252514	missense	probably damaging	0.97
IGL03126:Rasa1	APN	13	85256396	missense	possibly damaging	0.94
F5770:Rasa1	UTSW	13	85226945	splice site	probably null
PIT4458001:Rasa1	UTSW	13	85227118	missense	possibly damaging	0.91
R1393:Rasa1	UTSW	13	85223522	missense	probably damaging	1.00
R1441:Rasa1	UTSW	13	85252421	splice site	probably null
R1907:Rasa1	UTSW	13	85226572	nonsense	probably null
R4243:Rasa1	UTSW	13	85244195	missense	probably damaging	1.00
R4593:Rasa1	UTSW	13	85238221	splice site	probably null
R4687:Rasa1	UTSW	13	85226635	missense	possibly damaging	0.89
R4689:Rasa1	UTSW	13	85238163	nonsense	probably null
R4753:Rasa1	UTSW	13	85288390	splice site	probably null
R4774:Rasa1	UTSW	13	85250502	intron	probably benign
R5363:Rasa1	UTSW	13	85288555	missense	possibly damaging	0.86
R5375:Rasa1	UTSW	13	85288903	intron	probably benign
R6134:Rasa1	UTSW	13	85226626	missense	probably benign	0.01
R6190:Rasa1	UTSW	13	85233695	missense	probably benign	0.02
R6755:Rasa1	UTSW	13	85226598	missense	possibly damaging	0.49
R7564:Rasa1	UTSW	13	85228708	missense	probably benign	0.09
R7862:Rasa1	UTSW	13	85255411	missense	probably damaging	0.99
R9138:Rasa1	UTSW	13	85221516	missense	possibly damaging	0.93
R9280:Rasa1	UTSW	13	85288613	missense	unknown
R9328:Rasa1	UTSW	13	85255456	critical splice acceptor site	probably null
R9340:Rasa1	UTSW	13	85221530	missense	probably damaging	0.98
R9648:Rasa1	UTSW	13	85288571	missense	possibly damaging	0.73
RF016:Rasa1	UTSW	13	85223488	missense	possibly damaging	0.65
X0023:Rasa1	UTSW	13	85233734	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTCTATGTGGAAGCTCTGAAC -3'
(R):5'- CCGGCATTTGTCCATGAGAC -3'

Sequencing Primer
(F):5'- GTGGAAGCTCTGAACAAATACTTG -3'
(R):5'- CCATGAGACATTGTTCTTAAGAAATG -3'

Posted On

2015-11-11