Incidental Mutation 'R4758:Osmr'
ID358358
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4758 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6852555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 36 (I36K)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably benign
Transcript: ENSMUST00000022746
AA Change: I36K

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: I36K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175862
Predicted Effect probably benign
Transcript: ENSMUST00000176826
AA Change: I36K

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: I36K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177478
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nbea T C 3: 56,005,403 M988V probably benign Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1a A G 5: 120,907,338 F47L probably damaging Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Plekhm2 A T 4: 141,642,005 Y123N possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Rasa1 A T 13: 85,234,448 D446E probably benign Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Spata5 T A 3: 37,433,236 S416T probably benign Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Srebf2 T C 15: 82,196,169 V821A probably benign Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACAGGGATGCAATTGTTTAG -3'
(R):5'- AGCTTCTCTCAGATTCTGATGC -3'

Sequencing Primer
(F):5'- CAGGGATGCAATTGTTTAGGAAATC -3'
(R):5'- CTCTCAGATTCTGATGCTAGGATGC -3'
Posted On2015-11-11