Incidental Mutation 'R4758:Srebf2'
ID358359
Institutional Source Beutler Lab
Gene Symbol Srebf2
Ensembl Gene ENSMUSG00000022463
Gene Namesterol regulatory element binding factor 2
Synonymsnuc, bHLHd2, lop13, SREBP-2, SREBP2gc, SREBP2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4758 (G1)
Quality Score224
Status Not validated
Chromosome15
Chromosomal Location82147181-82205379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82196169 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 821 (V821A)
Ref Sequence ENSEMBL: ENSMUSP00000155022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023100] [ENSMUST00000229336]
Predicted Effect probably benign
Transcript: ENSMUST00000023100
AA Change: V861A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023100
Gene: ENSMUSG00000022463
AA Change: V861A

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 118 137 N/A INTRINSIC
low complexity region 178 204 N/A INTRINSIC
low complexity region 210 235 N/A INTRINSIC
HLH 325 375 3.54e-15 SMART
low complexity region 383 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083531
Predicted Effect probably benign
Transcript: ENSMUST00000229336
AA Change: V821A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect unknown
Transcript: ENSMUST00000230955
AA Change: V21A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display prenatal lethality. Mice homozygous for an ENU mutation display cataracts and persistent wounds of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nbea T C 3: 56,005,403 M988V probably benign Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1a A G 5: 120,907,338 F47L probably damaging Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Osmr A T 15: 6,852,555 I36K probably benign Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Plekhm2 A T 4: 141,642,005 Y123N possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Rasa1 A T 13: 85,234,448 D446E probably benign Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Spata5 T A 3: 37,433,236 S416T probably benign Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Srebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Srebf2 APN 15 82192203 unclassified probably benign
IGL01409:Srebf2 APN 15 82171218 missense probably damaging 1.00
IGL01415:Srebf2 APN 15 82177462 missense probably benign 0.08
IGL01614:Srebf2 APN 15 82178853 missense probably benign
IGL01985:Srebf2 APN 15 82192359 missense probably benign 0.01
IGL02423:Srebf2 APN 15 82175097 missense probably damaging 1.00
IGL02436:Srebf2 APN 15 82197727 missense probably benign 0.41
IGL02805:Srebf2 APN 15 82169844 missense probably benign 0.00
IGL02818:Srebf2 APN 15 82185374 missense probably damaging 0.99
IGL02823:Srebf2 APN 15 82199774 missense possibly damaging 0.87
IGL02895:Srebf2 APN 15 82147467 missense possibly damaging 0.72
IGL03064:Srebf2 APN 15 82192222 missense probably benign 0.01
IGL03378:Srebf2 APN 15 82169788 missense probably damaging 1.00
FR4449:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4548:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4737:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4976:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
R0230:Srebf2 UTSW 15 82182085 missense probably damaging 1.00
R0702:Srebf2 UTSW 15 82177409 missense probably damaging 1.00
R0829:Srebf2 UTSW 15 82177589 critical splice donor site probably null
R1241:Srebf2 UTSW 15 82177519 missense probably damaging 1.00
R1898:Srebf2 UTSW 15 82203735 missense probably damaging 1.00
R1957:Srebf2 UTSW 15 82194954 missense probably benign 0.26
R2395:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R3771:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3772:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3773:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R4030:Srebf2 UTSW 15 82178783 missense probably damaging 1.00
R4613:Srebf2 UTSW 15 82185348 missense possibly damaging 0.94
R4670:Srebf2 UTSW 15 82192302 missense probably damaging 1.00
R4812:Srebf2 UTSW 15 82203825 missense probably damaging 0.98
R5058:Srebf2 UTSW 15 82182050 missense probably damaging 0.99
R5063:Srebf2 UTSW 15 82177451 missense probably benign
R5155:Srebf2 UTSW 15 82196226 missense probably damaging 1.00
R5166:Srebf2 UTSW 15 82185402 missense probably damaging 1.00
R5330:Srebf2 UTSW 15 82196208 missense possibly damaging 0.88
R5398:Srebf2 UTSW 15 82171242 missense probably damaging 1.00
R5662:Srebf2 UTSW 15 82195003 missense probably benign 0.01
R5668:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R5867:Srebf2 UTSW 15 82169786 missense probably damaging 1.00
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6928:Srebf2 UTSW 15 82203723 nonsense probably null
R7269:Srebf2 UTSW 15 82204069 missense probably benign 0.00
R7464:Srebf2 UTSW 15 82172874 missense probably damaging 0.97
R7632:Srebf2 UTSW 15 82185296 missense probably benign
X0064:Srebf2 UTSW 15 82175220 missense probably damaging 1.00
Z1088:Srebf2 UTSW 15 82194921 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATGAGCGTGTTCAAGTC -3'
(R):5'- CCAGATCAACATGGCTATCTGG -3'

Sequencing Primer
(F):5'- GAGCGTGTTCAAGTCCTTGCTAC -3'
(R):5'- GATCAACATGGCTATCTGGACCTG -3'
Posted On2015-11-11