Mutagenetix > Incidental Mutations

Incidental Mutation 'R4725:Serpinb13'

358377

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

041960-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R4725 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106982844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 66 (S66L)

Ref Sequence

ENSEMBL: ENSMUSP00000118572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027564
AA Change: S66L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136766
AA Change: S66L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

96% (64/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830454E08Rik	T	C	9: 120,577,703		probably benign	Het
Adamts20	T	C	15: 94,351,762	E458G	probably damaging	Het
Adgrl3	T	C	5: 81,766,205	I1220T	possibly damaging	Het
Aldh1a1	T	A	19: 20,640,081	M459K	probably benign	Het
Arntl	C	A	7: 113,304,359	P454Q	possibly damaging	Het
Camta1	A	G	4: 151,148,496	V240A	probably benign	Het
Ccdc88b	C	T	19: 6,857,113	G149R	probably damaging	Het
Ceacam5	T	C	7: 17,760,677	V870A	probably benign	Het
Cep192	A	C	18: 67,816,766	Q307P	probably benign	Het
Cep63	T	C	9: 102,590,556		probably benign	Het
Cldn12	A	G	5: 5,508,385	F14S	probably damaging	Het
Ctdsp1	G	A	1: 74,394,664	V135I	possibly damaging	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dchs1	T	C	7: 105,755,253	D2694G	probably damaging	Het
Dchs1	C	G	7: 105,765,552	G761A	probably damaging	Het
Dennd5b	A	G	6: 149,044,779	Y445H	probably damaging	Het
Dock1	T	A	7: 134,745,014	L225*	probably null	Het
Drd3	G	T	16: 43,822,801	E467*	probably null	Het
Dysf	A	T	6: 84,097,756	N527I	probably damaging	Het
Erbb2	A	G	11: 98,425,144	T358A	possibly damaging	Het
Fhad1	A	T	4: 141,928,378		probably null	Het
Ganc	T	C	2: 120,435,273	I434T	probably damaging	Het
Gm15448	A	C	7: 3,821,548	S611A	probably benign	Het
Gm5830	T	A	1: 78,967,832		noncoding transcript	Het
Gm6096	G	T	7: 34,251,059	E8*	probably null	Het
Gne	A	G	4: 44,066,806	F63S	probably benign	Het
Gpat2	T	C	2: 127,431,982	V315A	possibly damaging	Het
Gpr33	A	G	12: 52,024,109	L49P	probably damaging	Het
Heatr1	C	T	13: 12,424,662	Q1374*	probably null	Het
Hivep1	A	G	13: 42,163,411	I2032V	probably benign	Het
Igkv2-112	A	C	6: 68,220,466	I40L	probably benign	Het
Kcnab3	A	G	11: 69,330,468	N204D	probably benign	Het
Kcnj10	T	A	1: 172,369,159	F80Y	probably damaging	Het
Lcmt2	C	G	2: 121,139,430	V171L	probably benign	Het
Loxhd1	T	A	18: 77,395,457	Y1245N	probably damaging	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Mast1	A	G	8: 84,929,006	S170P	possibly damaging	Het
Mroh4	A	G	15: 74,616,107	L322P	probably damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Nudcd3	A	T	11: 6,193,475	V1D	probably damaging	Het
Pah	T	A	10: 87,554,376	L25Q	probably damaging	Het
Pik3cg	A	T	12: 32,193,597		probably null	Het
Plekha6	C	A	1: 133,283,320	S625Y	probably damaging	Het
Rtn4	T	A	11: 29,708,362	S839T	probably damaging	Het
Rusc1	A	G	3: 89,091,429	S349P	possibly damaging	Het
Samsn1	A	T	16: 75,945,329		noncoding transcript	Het
Scimp	A	G	11: 70,800,713	V30A	probably damaging	Het
Sgip1	A	G	4: 102,966,222	D680G	probably damaging	Het
Slc44a2	G	A	9: 21,348,395	V613M	probably damaging	Het
Smpdl3b	T	C	4: 132,745,178	T95A	probably damaging	Het
Spag6l	A	T	16: 16,792,531	L85H	probably damaging	Het
Sucla2	T	A	14: 73,568,989	Y167N	possibly damaging	Het
Svop	G	T	5: 114,065,485		probably benign	Het
Tnxb	A	T	17: 34,699,067	D2318V	probably damaging	Het
Trbv14	A	G	6: 41,135,398	D43G	probably benign	Het
Ubn2	A	G	6: 38,522,305		probably benign	Het
Ufsp1	T	C	5: 137,295,307	I173T	probably damaging	Het
Zbtb40	A	G	4: 137,018,761		probably benign	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGCAACATAGACATTTCTCTGG -3'
(R):5'- TCCAGGAGCTTTTGAGCAAG -3'

Sequencing Primer
(F):5'- AGACATTTCTCTGGCTTTTCAAGGAG -3'
(R):5'- AGCCTCTAGGACTTTGTTATAGCAGC -3'

Posted On

2015-11-11