Incidental Mutation 'R4725:Gne'
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
MMRRC Submission 041960-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4725 (G1)
Quality Score225
Status Not validated
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44066806 bp
Amino Acid Change Phenylalanine to Serine at position 63 (F63S)
Ref Sequence ENSEMBL: ENSMUSP00000122793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000128439] [ENSMUST00000133709] [ENSMUST00000140724] [ENSMUST00000144985] [ENSMUST00000172533] [ENSMUST00000173234] [ENSMUST00000173274] [ENSMUST00000173383]
Predicted Effect probably benign
Transcript: ENSMUST00000030201
AA Change: F69S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: F69S

Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102936
AA Change: F38S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: F38S

Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128439
AA Change: F63S

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000133709
AA Change: F38S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000140724
AA Change: F63S

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000144985
AA Change: F77S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118443
Gene: ENSMUSG00000028479
AA Change: F77S

Pfam:Epimerase_2 71 213 1.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172514
Predicted Effect probably benign
Transcript: ENSMUST00000172533
AA Change: F38S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479
AA Change: F38S

Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173234
AA Change: F38S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: F38S

Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173274
AA Change: F38S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134406
Gene: ENSMUSG00000028479
AA Change: F38S

Pfam:Epimerase_2 32 292 2.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173383
AA Change: F38S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133440
Gene: ENSMUSG00000028479
AA Change: F38S

Pfam:Epimerase_2 32 133 3.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173976
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,703 probably benign Het
Adamts20 T C 15: 94,351,762 E458G probably damaging Het
Adgrl3 T C 5: 81,766,205 I1220T possibly damaging Het
Aldh1a1 T A 19: 20,640,081 M459K probably benign Het
Arntl C A 7: 113,304,359 P454Q possibly damaging Het
Camta1 A G 4: 151,148,496 V240A probably benign Het
Ccdc88b C T 19: 6,857,113 G149R probably damaging Het
Ceacam5 T C 7: 17,760,677 V870A probably benign Het
Cep192 A C 18: 67,816,766 Q307P probably benign Het
Cep63 T C 9: 102,590,556 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Ctdsp1 G A 1: 74,394,664 V135I possibly damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dchs1 C G 7: 105,765,552 G761A probably damaging Het
Dennd5b A G 6: 149,044,779 Y445H probably damaging Het
Dock1 T A 7: 134,745,014 L225* probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Dysf A T 6: 84,097,756 N527I probably damaging Het
Erbb2 A G 11: 98,425,144 T358A possibly damaging Het
Fhad1 A T 4: 141,928,378 probably null Het
Ganc T C 2: 120,435,273 I434T probably damaging Het
Gm15448 A C 7: 3,821,548 S611A probably benign Het
Gm5830 T A 1: 78,967,832 noncoding transcript Het
Gm6096 G T 7: 34,251,059 E8* probably null Het
Gpat2 T C 2: 127,431,982 V315A possibly damaging Het
Gpr33 A G 12: 52,024,109 L49P probably damaging Het
Heatr1 C T 13: 12,424,662 Q1374* probably null Het
Hivep1 A G 13: 42,163,411 I2032V probably benign Het
Igkv2-112 A C 6: 68,220,466 I40L probably benign Het
Kcnab3 A G 11: 69,330,468 N204D probably benign Het
Kcnj10 T A 1: 172,369,159 F80Y probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Loxhd1 T A 18: 77,395,457 Y1245N probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Mast1 A G 8: 84,929,006 S170P possibly damaging Het
Mroh4 A G 15: 74,616,107 L322P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nudcd3 A T 11: 6,193,475 V1D probably damaging Het
Pah T A 10: 87,554,376 L25Q probably damaging Het
Pik3cg A T 12: 32,193,597 probably null Het
Plekha6 C A 1: 133,283,320 S625Y probably damaging Het
Rtn4 T A 11: 29,708,362 S839T probably damaging Het
Rusc1 A G 3: 89,091,429 S349P possibly damaging Het
Samsn1 A T 16: 75,945,329 noncoding transcript Het
Scimp A G 11: 70,800,713 V30A probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sgip1 A G 4: 102,966,222 D680G probably damaging Het
Slc44a2 G A 9: 21,348,395 V613M probably damaging Het
Smpdl3b T C 4: 132,745,178 T95A probably damaging Het
Spag6l A T 16: 16,792,531 L85H probably damaging Het
Sucla2 T A 14: 73,568,989 Y167N possibly damaging Het
Svop G T 5: 114,065,485 probably benign Het
Tnxb A T 17: 34,699,067 D2318V probably damaging Het
Trbv14 A G 6: 41,135,398 D43G probably benign Het
Ubn2 A G 6: 38,522,305 probably benign Het
Ufsp1 T C 5: 137,295,307 I173T probably damaging Het
Zbtb40 A G 4: 137,018,761 probably benign Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 splice site probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
R7170:Gne UTSW 4 44040361 missense possibly damaging 0.95
R7191:Gne UTSW 4 44040266 missense probably benign 0.16
R7264:Gne UTSW 4 44042175 missense probably damaging 0.96
R7413:Gne UTSW 4 44044857 missense probably benign 0.06
R7956:Gne UTSW 4 44044962 missense probably benign 0.32
R8184:Gne UTSW 4 44084061 missense probably benign 0.07
R8734:Gne UTSW 4 44072911 unclassified probably benign
RF012:Gne UTSW 4 44060045 missense probably damaging 1.00
RF014:Gne UTSW 4 44060045 missense probably damaging 1.00
Predicted Primers
Posted On2015-11-11