Incidental Mutation 'R4725:Cep63'
ID358413
Institutional Source Beutler Lab
Gene Symbol Cep63
Ensembl Gene ENSMUSG00000032534
Gene Namecentrosomal protein 63
SynonymsD9Mgc48e, CD20R, D9Mgc41, ET2
MMRRC Submission 041960-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R4725 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location102584588-102626534 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 102590556 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093791] [ENSMUST00000162655] [ENSMUST00000216281]
Predicted Effect probably benign
Transcript: ENSMUST00000093791
SMART Domains Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:CEP63 76 338 8.1e-112 PFAM
coiled coil region 401 469 N/A INTRINSIC
coiled coil region 492 591 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
coiled coil region 730 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162655
SMART Domains Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
coiled coil region 72 220 N/A INTRINSIC
coiled coil region 243 283 N/A INTRINSIC
coiled coil region 343 411 N/A INTRINSIC
coiled coil region 434 484 N/A INTRINSIC
coiled coil region 510 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192240
Predicted Effect probably benign
Transcript: ENSMUST00000216281
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,703 probably benign Het
Adamts20 T C 15: 94,351,762 E458G probably damaging Het
Adgrl3 T C 5: 81,766,205 I1220T possibly damaging Het
Aldh1a1 T A 19: 20,640,081 M459K probably benign Het
Arntl C A 7: 113,304,359 P454Q possibly damaging Het
Camta1 A G 4: 151,148,496 V240A probably benign Het
Ccdc88b C T 19: 6,857,113 G149R probably damaging Het
Ceacam5 T C 7: 17,760,677 V870A probably benign Het
Cep192 A C 18: 67,816,766 Q307P probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Ctdsp1 G A 1: 74,394,664 V135I possibly damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dchs1 C G 7: 105,765,552 G761A probably damaging Het
Dennd5b A G 6: 149,044,779 Y445H probably damaging Het
Dock1 T A 7: 134,745,014 L225* probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Dysf A T 6: 84,097,756 N527I probably damaging Het
Erbb2 A G 11: 98,425,144 T358A possibly damaging Het
Fhad1 A T 4: 141,928,378 probably null Het
Ganc T C 2: 120,435,273 I434T probably damaging Het
Gm15448 A C 7: 3,821,548 S611A probably benign Het
Gm5830 T A 1: 78,967,832 noncoding transcript Het
Gm6096 G T 7: 34,251,059 E8* probably null Het
Gne A G 4: 44,066,806 F63S probably benign Het
Gpat2 T C 2: 127,431,982 V315A possibly damaging Het
Gpr33 A G 12: 52,024,109 L49P probably damaging Het
Heatr1 C T 13: 12,424,662 Q1374* probably null Het
Hivep1 A G 13: 42,163,411 I2032V probably benign Het
Igkv2-112 A C 6: 68,220,466 I40L probably benign Het
Kcnab3 A G 11: 69,330,468 N204D probably benign Het
Kcnj10 T A 1: 172,369,159 F80Y probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Loxhd1 T A 18: 77,395,457 Y1245N probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Mast1 A G 8: 84,929,006 S170P possibly damaging Het
Mroh4 A G 15: 74,616,107 L322P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nudcd3 A T 11: 6,193,475 V1D probably damaging Het
Pah T A 10: 87,554,376 L25Q probably damaging Het
Pik3cg A T 12: 32,193,597 probably null Het
Plekha6 C A 1: 133,283,320 S625Y probably damaging Het
Rtn4 T A 11: 29,708,362 S839T probably damaging Het
Rusc1 A G 3: 89,091,429 S349P possibly damaging Het
Samsn1 A T 16: 75,945,329 noncoding transcript Het
Scimp A G 11: 70,800,713 V30A probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sgip1 A G 4: 102,966,222 D680G probably damaging Het
Slc44a2 G A 9: 21,348,395 V613M probably damaging Het
Smpdl3b T C 4: 132,745,178 T95A probably damaging Het
Spag6l A T 16: 16,792,531 L85H probably damaging Het
Sucla2 T A 14: 73,568,989 Y167N possibly damaging Het
Svop G T 5: 114,065,485 probably benign Het
Tnxb A T 17: 34,699,067 D2318V probably damaging Het
Trbv14 A G 6: 41,135,398 D43G probably benign Het
Ubn2 A G 6: 38,522,305 probably benign Het
Ufsp1 T C 5: 137,295,307 I173T probably damaging Het
Zbtb40 A G 4: 137,018,761 probably benign Het
Other mutations in Cep63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Cep63 APN 9 102590458 missense possibly damaging 0.88
IGL02378:Cep63 APN 9 102596115 splice site probably benign
IGL02707:Cep63 APN 9 102586981 missense probably damaging 1.00
IGL03273:Cep63 APN 9 102602467 missense probably benign 0.13
R0355:Cep63 UTSW 9 102623560 missense probably benign
R0847:Cep63 UTSW 9 102588758 missense probably benign 0.12
R1276:Cep63 UTSW 9 102588900 missense possibly damaging 0.77
R1398:Cep63 UTSW 9 102603086 splice site probably benign
R1654:Cep63 UTSW 9 102586913 missense possibly damaging 0.87
R1730:Cep63 UTSW 9 102618867 missense possibly damaging 0.93
R1982:Cep63 UTSW 9 102602880 missense probably damaging 0.99
R2359:Cep63 UTSW 9 102594564 missense possibly damaging 0.95
R2890:Cep63 UTSW 9 102618827 missense probably damaging 0.99
R3082:Cep63 UTSW 9 102602497 missense probably benign 0.00
R4761:Cep63 UTSW 9 102587041 intron probably benign
R5200:Cep63 UTSW 9 102598188 missense probably benign 0.22
R5538:Cep63 UTSW 9 102588793 nonsense probably null
R6463:Cep63 UTSW 9 102596155 missense probably benign
R6887:Cep63 UTSW 9 102625927 intron probably benign
R7854:Cep63 UTSW 9 102602998 missense probably damaging 1.00
R7937:Cep63 UTSW 9 102602998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGGTTAAAGATCTCGCC -3'
(R):5'- ATGCTTATGTACAGAAGGAAGCC -3'

Sequencing Primer
(F):5'- TCCAGCTCAGATTTGGTG -3'
(R):5'- GGAAGCCATCCTGCCTTTAAC -3'
Posted On2015-11-11