Incidental Mutation 'R4725:Pik3cg'
ID358422
Institutional Source Beutler Lab
Gene Symbol Pik3cg
Ensembl Gene ENSMUSG00000020573
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
SynonymsPI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma
MMRRC Submission 041960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4725 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location32173473-32208659 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 32193597 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]
Predicted Effect probably null
Transcript: ENSMUST00000053215
SMART Domains Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085469
SMART Domains Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156904
SMART Domains Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217915
Predicted Effect probably null
Transcript: ENSMUST00000220366
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,703 probably benign Het
Adamts20 T C 15: 94,351,762 E458G probably damaging Het
Adgrl3 T C 5: 81,766,205 I1220T possibly damaging Het
Aldh1a1 T A 19: 20,640,081 M459K probably benign Het
Arntl C A 7: 113,304,359 P454Q possibly damaging Het
Camta1 A G 4: 151,148,496 V240A probably benign Het
Ccdc88b C T 19: 6,857,113 G149R probably damaging Het
Ceacam5 T C 7: 17,760,677 V870A probably benign Het
Cep192 A C 18: 67,816,766 Q307P probably benign Het
Cep63 T C 9: 102,590,556 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Ctdsp1 G A 1: 74,394,664 V135I possibly damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dchs1 C G 7: 105,765,552 G761A probably damaging Het
Dennd5b A G 6: 149,044,779 Y445H probably damaging Het
Dock1 T A 7: 134,745,014 L225* probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Dysf A T 6: 84,097,756 N527I probably damaging Het
Erbb2 A G 11: 98,425,144 T358A possibly damaging Het
Fhad1 A T 4: 141,928,378 probably null Het
Ganc T C 2: 120,435,273 I434T probably damaging Het
Gm15448 A C 7: 3,821,548 S611A probably benign Het
Gm5830 T A 1: 78,967,832 noncoding transcript Het
Gm6096 G T 7: 34,251,059 E8* probably null Het
Gne A G 4: 44,066,806 F63S probably benign Het
Gpat2 T C 2: 127,431,982 V315A possibly damaging Het
Gpr33 A G 12: 52,024,109 L49P probably damaging Het
Heatr1 C T 13: 12,424,662 Q1374* probably null Het
Hivep1 A G 13: 42,163,411 I2032V probably benign Het
Igkv2-112 A C 6: 68,220,466 I40L probably benign Het
Kcnab3 A G 11: 69,330,468 N204D probably benign Het
Kcnj10 T A 1: 172,369,159 F80Y probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Loxhd1 T A 18: 77,395,457 Y1245N probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Mast1 A G 8: 84,929,006 S170P possibly damaging Het
Mroh4 A G 15: 74,616,107 L322P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nudcd3 A T 11: 6,193,475 V1D probably damaging Het
Pah T A 10: 87,554,376 L25Q probably damaging Het
Plekha6 C A 1: 133,283,320 S625Y probably damaging Het
Rtn4 T A 11: 29,708,362 S839T probably damaging Het
Rusc1 A G 3: 89,091,429 S349P possibly damaging Het
Samsn1 A T 16: 75,945,329 noncoding transcript Het
Scimp A G 11: 70,800,713 V30A probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sgip1 A G 4: 102,966,222 D680G probably damaging Het
Slc44a2 G A 9: 21,348,395 V613M probably damaging Het
Smpdl3b T C 4: 132,745,178 T95A probably damaging Het
Spag6l A T 16: 16,792,531 L85H probably damaging Het
Sucla2 T A 14: 73,568,989 Y167N possibly damaging Het
Svop G T 5: 114,065,485 probably benign Het
Tnxb A T 17: 34,699,067 D2318V probably damaging Het
Trbv14 A G 6: 41,135,398 D43G probably benign Het
Ubn2 A G 6: 38,522,305 probably benign Het
Ufsp1 T C 5: 137,295,307 I173T probably damaging Het
Zbtb40 A G 4: 137,018,761 probably benign Het
Other mutations in Pik3cg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pik3cg APN 12 32205149 missense probably damaging 1.00
IGL02182:Pik3cg APN 12 32205273 missense possibly damaging 0.90
IGL02273:Pik3cg APN 12 32176810 missense probably damaging 1.00
IGL02312:Pik3cg APN 12 32194821 missense possibly damaging 0.55
IGL02752:Pik3cg APN 12 32204263 missense probably damaging 1.00
IGL03107:Pik3cg APN 12 32200595 missense probably damaging 1.00
IGL03139:Pik3cg APN 12 32192223 missense probably damaging 1.00
IGL03267:Pik3cg APN 12 32205308 missense possibly damaging 0.94
IGL03367:Pik3cg APN 12 32192121 missense probably benign 0.01
PIT4283001:Pik3cg UTSW 12 32205865 missense probably damaging 1.00
PIT4472001:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
PIT4514001:Pik3cg UTSW 12 32204903 missense probably damaging 1.00
R0112:Pik3cg UTSW 12 32195715 splice site probably benign
R0145:Pik3cg UTSW 12 32204322 missense probably benign 0.20
R0279:Pik3cg UTSW 12 32204791 missense probably damaging 1.00
R0471:Pik3cg UTSW 12 32194771 missense probably damaging 0.99
R0494:Pik3cg UTSW 12 32204546 missense possibly damaging 0.84
R0573:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R0631:Pik3cg UTSW 12 32205203 missense probably benign
R0699:Pik3cg UTSW 12 32197342 splice site probably benign
R0826:Pik3cg UTSW 12 32195673 missense possibly damaging 0.78
R1076:Pik3cg UTSW 12 32195714 splice site probably benign
R1101:Pik3cg UTSW 12 32195646 missense probably null 0.98
R1459:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
R1625:Pik3cg UTSW 12 32194742 missense probably damaging 1.00
R1971:Pik3cg UTSW 12 32192153 missense probably damaging 1.00
R1992:Pik3cg UTSW 12 32204025 missense possibly damaging 0.83
R2109:Pik3cg UTSW 12 32193710 missense possibly damaging 0.75
R2319:Pik3cg UTSW 12 32176736 missense probably damaging 0.99
R3421:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3422:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3740:Pik3cg UTSW 12 32205224 missense probably damaging 1.00
R3777:Pik3cg UTSW 12 32194709 missense probably damaging 0.98
R4300:Pik3cg UTSW 12 32176672 missense probably damaging 1.00
R4395:Pik3cg UTSW 12 32204092 missense probably damaging 1.00
R4785:Pik3cg UTSW 12 32205199 missense probably damaging 0.97
R4809:Pik3cg UTSW 12 32204081 missense possibly damaging 0.46
R4981:Pik3cg UTSW 12 32204104 missense possibly damaging 0.77
R5033:Pik3cg UTSW 12 32199196 splice site probably null
R5161:Pik3cg UTSW 12 32204978 missense possibly damaging 0.92
R5806:Pik3cg UTSW 12 32204953 missense possibly damaging 0.88
R6136:Pik3cg UTSW 12 32204359 missense probably benign 0.00
R6746:Pik3cg UTSW 12 32194758 missense probably damaging 1.00
R6895:Pik3cg UTSW 12 32204347 missense possibly damaging 0.87
R7000:Pik3cg UTSW 12 32192129 missense probably damaging 1.00
R7089:Pik3cg UTSW 12 32176846 missense probably benign 0.00
R7113:Pik3cg UTSW 12 32205667 missense probably damaging 0.98
R7372:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R7483:Pik3cg UTSW 12 32195648 missense probably damaging 0.99
R7596:Pik3cg UTSW 12 32204741 missense probably damaging 1.00
R7771:Pik3cg UTSW 12 32204014 missense probably benign
R7910:Pik3cg UTSW 12 32200517 missense probably benign 0.16
R7991:Pik3cg UTSW 12 32200517 missense probably benign 0.16
Z1176:Pik3cg UTSW 12 32204795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTCTCACTCTGTGCCAG -3'
(R):5'- GAACACTGTTCTTCTGGGAGGC -3'

Sequencing Primer
(F):5'- TCACTCTGTGCCAGGAGGATG -3'
(R):5'- CATTGCCATTGACTTGGGC -3'
Posted On2015-11-11