Incidental Mutation 'R4726:Rnf20'
ID 358447
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
MMRRC Submission 041989-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4726 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 49654579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 879 (R879*)
Ref Sequence ENSEMBL: ENSMUSP00000128546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000156314] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect probably null
Transcript: ENSMUST00000029989
AA Change: R879*
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: R879*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138490
Predicted Effect probably benign
Transcript: ENSMUST00000156314
SMART Domains Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
SCOP:d1gw5a_ 174 294 3e-3 SMART
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167496
AA Change: R879*
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: R879*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T C 17: 64,834,453 S52G probably null Het
Abcc2 T C 19: 43,832,114 S1351P probably benign Het
Acp2 T A 2: 91,204,277 L87Q probably damaging Het
Adgrl3 C A 5: 81,646,578 T550K possibly damaging Het
AI314180 A G 4: 58,844,191 V525A probably damaging Het
Amotl2 A G 9: 102,723,819 R329G probably benign Het
Angel1 T C 12: 86,721,875 N278S probably damaging Het
Ankrd12 A C 17: 65,970,324 M1985R probably damaging Het
Apob T A 12: 7,990,267 F535I probably damaging Het
Art3 A G 5: 92,411,143 K313R probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Bsph1 A T 7: 13,472,995 M99L probably benign Het
C330027C09Rik A G 16: 49,014,070 T672A probably benign Het
Ccdc153 T C 9: 44,243,666 probably null Het
Cdh16 A T 8: 104,616,032 M28K probably damaging Het
Cdhr2 T C 13: 54,718,539 F353L probably damaging Het
Chrna2 G T 14: 66,148,896 V164L possibly damaging Het
Ckmt1 T C 2: 121,361,231 probably null Het
Col25a1 A T 3: 130,519,781 E280V possibly damaging Het
Dnajc12 A G 10: 63,397,308 D76G probably damaging Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Ehbp1l1 C A 19: 5,719,176 A700S possibly damaging Het
Gab1 T C 8: 80,789,053 D212G possibly damaging Het
Gm21818 A T 13: 120,173,637 S152C possibly damaging Het
Gm26996 A G 6: 130,580,171 noncoding transcript Het
Gm28113 A G 15: 75,326,728 noncoding transcript Het
Has3 T C 8: 106,878,086 F308S probably damaging Het
Ifit3b T A 19: 34,611,460 I12N probably benign Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ints3 A G 3: 90,393,777 S840P probably damaging Het
Itih4 T C 14: 30,889,835 V132A probably damaging Het
Kcnj10 A G 1: 172,369,072 Y51C probably damaging Het
Klk1b24 G A 7: 44,190,396 V60I probably damaging Het
Klra14-ps C A 6: 130,157,663 noncoding transcript Het
Krt6b A G 15: 101,678,085 I323T probably damaging Het
Lilra5 A C 7: 4,237,958 Q17P probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k4 T C 17: 12,232,964 N1479S possibly damaging Het
Mbd3l2 A T 9: 18,444,960 I194F probably damaging Het
Megf10 T C 18: 57,287,792 I834T probably benign Het
Mterf4 G A 1: 93,301,749 T251M probably damaging Het
Mtmr3 A T 11: 4,507,634 D170E probably damaging Het
Myom3 C T 4: 135,807,275 probably null Het
Nemp1 G A 10: 127,694,593 V305I probably benign Het
Nlrp1b G T 11: 71,181,406 T537K probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1066 A G 2: 86,456,236 F12L possibly damaging Het
Olfr1469 T A 19: 13,411,105 C179S probably damaging Het
Olfr776 A G 10: 129,261,176 T72A possibly damaging Het
Pias1 A G 9: 62,920,489 V212A probably damaging Het
Plscr1 T A 9: 92,263,168 V77D probably damaging Het
Plxna1 T C 6: 89,322,816 N1657S probably damaging Het
Ptprf A G 4: 118,212,217 V1551A possibly damaging Het
Ptprn2 C A 12: 117,247,773 Y857* probably null Het
Puf60 A T 15: 76,072,334 probably null Het
Robo1 G A 16: 72,972,043 A499T probably damaging Het
Slc39a14 A G 14: 70,313,599 probably null Het
Smarcad1 A T 6: 65,075,041 H6L probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Ssfa2 T A 2: 79,662,757 I1216N probably damaging Het
Stk39 T A 2: 68,263,303 D488V probably damaging Het
Stx19 A G 16: 62,822,132 N104D probably benign Het
Tmem222 T C 4: 133,277,664 M21V probably benign Het
Trim43b T A 9: 89,089,485 N205I possibly damaging Het
Ubr4 C A 4: 139,482,579 H5017N possibly damaging Het
Vmn2r93 A G 17: 18,316,698 T548A probably damaging Het
Vps8 G A 16: 21,448,404 probably null Het
Wasl A G 6: 24,633,111 V176A probably benign Het
Wbp2nl T A 15: 82,306,054 V61E probably damaging Het
Zfp959 T A 17: 55,898,260 probably null Het
Zmiz1 T C 14: 25,643,674 probably null Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4770:Rnf20 UTSW 4 49633412 critical splice donor site probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5379:Rnf20 UTSW 4 49652639 missense possibly damaging 0.47
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R6608:Rnf20 UTSW 4 49650051 missense probably benign 0.05
R7064:Rnf20 UTSW 4 49644580 nonsense probably null
R7776:Rnf20 UTSW 4 49644592 nonsense probably null
R8735:Rnf20 UTSW 4 49655964 missense possibly damaging 0.95
R8995:Rnf20 UTSW 4 49648437 missense possibly damaging 0.94
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCTCCTTAGAAGAATCAGGTCTG -3'
(R):5'- AACAAGTGAGATTTTAACCTTCCCC -3'

Sequencing Primer
(F):5'- CCTTAGAAGAATCAGGTCTGTTTCTG -3'
(R):5'- GTGACTACTTACCAGTTACCAGG -3'
Posted On 2015-11-11