Incidental Mutation 'R0321:Sprr1a'
ID 35846
Institutional Source Beutler Lab
Gene Symbol Sprr1a
Ensembl Gene ENSMUSG00000050359
Gene Name small proline-rich protein 1A
Synonyms
MMRRC Submission 038531-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0321 (G1)
Quality Score 217
Status Validated
Chromosome 3
Chromosomal Location 92391261-92393188 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92391609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 131 (T131A)
Ref Sequence ENSEMBL: ENSMUSP00000053751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054599]
AlphaFold Q62266
Predicted Effect probably benign
Transcript: ENSMUST00000054599
AA Change: T131A

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053751
Gene: ENSMUSG00000050359
AA Change: T131A

DomainStartEndE-ValueType
Pfam:Cornifin 17 142 6.1e-54 PFAM
Meta Mutation Damage Score 0.1739 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,620 (GRCm39) T353A probably benign Het
4933402N03Rik T A 7: 130,747,956 (GRCm39) Y12F probably benign Het
Acbd3 T G 1: 180,579,870 (GRCm39) F505V probably damaging Het
Acod1 T C 14: 103,292,565 (GRCm39) V363A probably benign Het
Adam28 T C 14: 68,855,200 (GRCm39) Q647R probably damaging Het
Akr1c18 T A 13: 4,185,243 (GRCm39) L296F probably damaging Het
Ap1b1 G A 11: 4,982,464 (GRCm39) A588T probably benign Het
Armc8 A T 9: 99,415,230 (GRCm39) I150K probably damaging Het
Bahcc1 T C 11: 120,164,251 (GRCm39) probably null Het
Bltp1 T C 3: 36,960,937 (GRCm39) probably null Het
Carmil3 C A 14: 55,739,698 (GRCm39) D928E possibly damaging Het
Ccrl2 T C 9: 110,885,279 (GRCm39) N73S probably damaging Het
Cdk9 C A 2: 32,602,698 (GRCm39) probably benign Het
Cel G T 2: 28,451,160 (GRCm39) Q66K probably benign Het
D930028M14Rik T A 7: 24,854,991 (GRCm39) noncoding transcript Het
Dgka G C 10: 128,556,952 (GRCm39) probably benign Het
Dlg1 T C 16: 31,676,854 (GRCm39) V801A probably damaging Het
Dnah10 A G 5: 124,900,416 (GRCm39) D3834G probably benign Het
Dnajc15 C T 14: 78,112,273 (GRCm39) A23T possibly damaging Het
Ell2 T A 13: 75,910,007 (GRCm39) L119Q probably damaging Het
Epha2 T C 4: 141,035,716 (GRCm39) W51R probably damaging Het
F10 T C 8: 13,103,413 (GRCm39) F266L possibly damaging Het
Fam110a T C 2: 151,812,587 (GRCm39) N61S probably benign Het
Fam83c C T 2: 155,671,620 (GRCm39) S605N probably benign Het
Fbxw15 C T 9: 109,394,453 (GRCm39) V121I probably benign Het
Gart G A 16: 91,419,925 (GRCm39) probably benign Het
Gfi1b A G 2: 28,503,897 (GRCm39) F101S probably damaging Het
Gimap5 C G 6: 48,727,449 (GRCm39) probably benign Het
Gpr180 T C 14: 118,385,699 (GRCm39) probably null Het
Gsn T C 2: 35,180,408 (GRCm39) F188L probably benign Het
Hivep3 T A 4: 119,952,788 (GRCm39) I368N possibly damaging Het
Itih3 T A 14: 30,634,063 (GRCm39) I153F probably damaging Het
Kdm8 A T 7: 125,060,178 (GRCm39) Q360L probably damaging Het
Lars1 T C 18: 42,335,697 (GRCm39) K1140E probably damaging Het
Mocs1 A G 17: 49,740,286 (GRCm39) Y71C probably damaging Het
Mroh5 C T 15: 73,661,892 (GRCm39) G433E probably damaging Het
Mrpl45 T A 11: 97,217,764 (GRCm39) probably benign Het
Mtcl1 T A 17: 66,686,426 (GRCm39) T827S probably damaging Het
Muc5b T C 7: 141,415,972 (GRCm39) S2973P probably benign Het
Mynn T C 3: 30,661,706 (GRCm39) S263P probably benign Het
Myo1f A C 17: 33,811,986 (GRCm39) D595A probably benign Het
Necab1 A T 4: 14,960,083 (GRCm39) I288N probably damaging Het
Nutm2 T G 13: 50,626,991 (GRCm39) M382R probably damaging Het
Oprm1 T C 10: 6,779,183 (GRCm39) S131P probably damaging Het
Pcsk9 A G 4: 106,301,891 (GRCm39) S619P probably benign Het
Phkg1 A T 5: 129,898,365 (GRCm39) M1K probably null Het
Pigc C T 1: 161,798,668 (GRCm39) Q217* probably null Het
Pik3r4 T A 9: 105,525,906 (GRCm39) F259I probably damaging Het
Pkdcc A T 17: 83,529,541 (GRCm39) probably benign Het
Pnpla5 G T 15: 84,004,920 (GRCm39) L144M probably damaging Het
Prtg A T 9: 72,755,307 (GRCm39) I259F possibly damaging Het
Prune2 T G 19: 17,098,291 (GRCm39) L1265R possibly damaging Het
Prune2 C T 19: 17,099,818 (GRCm39) A1774V probably benign Het
Rcn3 A G 7: 44,738,139 (GRCm39) probably benign Het
Rnf213 C T 11: 119,328,931 (GRCm39) Q2067* probably null Het
Sec14l1 T A 11: 117,041,568 (GRCm39) probably benign Het
Serpinb3a C T 1: 106,975,212 (GRCm39) W198* probably null Het
Smpdl3b A T 4: 132,468,755 (GRCm39) V154E probably damaging Het
Spag17 T C 3: 100,008,719 (GRCm39) S1950P probably damaging Het
Tatdn2 T G 6: 113,686,462 (GRCm39) L690W probably damaging Het
Tbc1d1 T C 5: 64,496,937 (GRCm39) F864L probably damaging Het
Tmem8b C A 4: 43,674,444 (GRCm39) R243S probably damaging Het
Tnfrsf11a T A 1: 105,772,583 (GRCm39) C623* probably null Het
Tprg1l T C 4: 154,243,812 (GRCm39) N115D probably damaging Het
Ube2t C T 1: 134,895,538 (GRCm39) A4V possibly damaging Het
Vps41 G A 13: 19,026,465 (GRCm39) probably benign Het
Wdr17 C T 8: 55,149,303 (GRCm39) probably null Het
Wwc1 G A 11: 35,732,637 (GRCm39) Q1024* probably null Het
Zfand5 T A 19: 21,253,879 (GRCm39) N27K probably damaging Het
Zfp142 A T 1: 74,608,873 (GRCm39) C1641S probably damaging Het
Zfyve16 A G 13: 92,629,042 (GRCm39) I1465T probably damaging Het
Zswim1 G A 2: 164,667,947 (GRCm39) G400S probably benign Het
Zswim3 C T 2: 164,662,279 (GRCm39) A253V possibly damaging Het
Other mutations in Sprr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Sprr1a APN 3 92,391,884 (GRCm39) missense probably benign 0.03
R3758:Sprr1a UTSW 3 92,391,704 (GRCm39) missense probably damaging 1.00
R3883:Sprr1a UTSW 3 92,391,827 (GRCm39) missense probably damaging 0.99
R5889:Sprr1a UTSW 3 92,391,951 (GRCm39) missense probably benign 0.24
R7195:Sprr1a UTSW 3 92,391,674 (GRCm39) missense probably damaging 1.00
R8295:Sprr1a UTSW 3 92,391,849 (GRCm39) missense possibly damaging 0.89
R8771:Sprr1a UTSW 3 92,391,989 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGGTCACAGCATTGGTAGCACAAG -3'
(R):5'- ATGAGTTCCCACCAGCAGAAGCAG -3'

Sequencing Primer
(F):5'- TAGCACAAGGCAATGGGACTC -3'
(R):5'- TGAAGCAGCCTTGCCAG -3'
Posted On 2013-05-09