Incidental Mutation 'R0321:Spag17'
ID 35847
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Name sperm associated antigen 17
Synonyms PF6, 4931427F14Rik
MMRRC Submission 038531-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0321 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 99792722-100050638 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100008719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1950 (S1950P)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
AlphaFold Q5S003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145279
Predicted Effect probably damaging
Transcript: ENSMUST00000164539
AA Change: S1950P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: S1950P

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,620 (GRCm39) T353A probably benign Het
4933402N03Rik T A 7: 130,747,956 (GRCm39) Y12F probably benign Het
Acbd3 T G 1: 180,579,870 (GRCm39) F505V probably damaging Het
Acod1 T C 14: 103,292,565 (GRCm39) V363A probably benign Het
Adam28 T C 14: 68,855,200 (GRCm39) Q647R probably damaging Het
Akr1c18 T A 13: 4,185,243 (GRCm39) L296F probably damaging Het
Ap1b1 G A 11: 4,982,464 (GRCm39) A588T probably benign Het
Armc8 A T 9: 99,415,230 (GRCm39) I150K probably damaging Het
Bahcc1 T C 11: 120,164,251 (GRCm39) probably null Het
Bltp1 T C 3: 36,960,937 (GRCm39) probably null Het
Carmil3 C A 14: 55,739,698 (GRCm39) D928E possibly damaging Het
Ccrl2 T C 9: 110,885,279 (GRCm39) N73S probably damaging Het
Cdk9 C A 2: 32,602,698 (GRCm39) probably benign Het
Cel G T 2: 28,451,160 (GRCm39) Q66K probably benign Het
D930028M14Rik T A 7: 24,854,991 (GRCm39) noncoding transcript Het
Dgka G C 10: 128,556,952 (GRCm39) probably benign Het
Dlg1 T C 16: 31,676,854 (GRCm39) V801A probably damaging Het
Dnah10 A G 5: 124,900,416 (GRCm39) D3834G probably benign Het
Dnajc15 C T 14: 78,112,273 (GRCm39) A23T possibly damaging Het
Ell2 T A 13: 75,910,007 (GRCm39) L119Q probably damaging Het
Epha2 T C 4: 141,035,716 (GRCm39) W51R probably damaging Het
F10 T C 8: 13,103,413 (GRCm39) F266L possibly damaging Het
Fam110a T C 2: 151,812,587 (GRCm39) N61S probably benign Het
Fam83c C T 2: 155,671,620 (GRCm39) S605N probably benign Het
Fbxw15 C T 9: 109,394,453 (GRCm39) V121I probably benign Het
Gart G A 16: 91,419,925 (GRCm39) probably benign Het
Gfi1b A G 2: 28,503,897 (GRCm39) F101S probably damaging Het
Gimap5 C G 6: 48,727,449 (GRCm39) probably benign Het
Gpr180 T C 14: 118,385,699 (GRCm39) probably null Het
Gsn T C 2: 35,180,408 (GRCm39) F188L probably benign Het
Hivep3 T A 4: 119,952,788 (GRCm39) I368N possibly damaging Het
Itih3 T A 14: 30,634,063 (GRCm39) I153F probably damaging Het
Kdm8 A T 7: 125,060,178 (GRCm39) Q360L probably damaging Het
Lars1 T C 18: 42,335,697 (GRCm39) K1140E probably damaging Het
Mocs1 A G 17: 49,740,286 (GRCm39) Y71C probably damaging Het
Mroh5 C T 15: 73,661,892 (GRCm39) G433E probably damaging Het
Mrpl45 T A 11: 97,217,764 (GRCm39) probably benign Het
Mtcl1 T A 17: 66,686,426 (GRCm39) T827S probably damaging Het
Muc5b T C 7: 141,415,972 (GRCm39) S2973P probably benign Het
Mynn T C 3: 30,661,706 (GRCm39) S263P probably benign Het
Myo1f A C 17: 33,811,986 (GRCm39) D595A probably benign Het
Necab1 A T 4: 14,960,083 (GRCm39) I288N probably damaging Het
Nutm2 T G 13: 50,626,991 (GRCm39) M382R probably damaging Het
Oprm1 T C 10: 6,779,183 (GRCm39) S131P probably damaging Het
Pcsk9 A G 4: 106,301,891 (GRCm39) S619P probably benign Het
Phkg1 A T 5: 129,898,365 (GRCm39) M1K probably null Het
Pigc C T 1: 161,798,668 (GRCm39) Q217* probably null Het
Pik3r4 T A 9: 105,525,906 (GRCm39) F259I probably damaging Het
Pkdcc A T 17: 83,529,541 (GRCm39) probably benign Het
Pnpla5 G T 15: 84,004,920 (GRCm39) L144M probably damaging Het
Prtg A T 9: 72,755,307 (GRCm39) I259F possibly damaging Het
Prune2 T G 19: 17,098,291 (GRCm39) L1265R possibly damaging Het
Prune2 C T 19: 17,099,818 (GRCm39) A1774V probably benign Het
Rcn3 A G 7: 44,738,139 (GRCm39) probably benign Het
Rnf213 C T 11: 119,328,931 (GRCm39) Q2067* probably null Het
Sec14l1 T A 11: 117,041,568 (GRCm39) probably benign Het
Serpinb3a C T 1: 106,975,212 (GRCm39) W198* probably null Het
Smpdl3b A T 4: 132,468,755 (GRCm39) V154E probably damaging Het
Sprr1a T C 3: 92,391,609 (GRCm39) T131A probably benign Het
Tatdn2 T G 6: 113,686,462 (GRCm39) L690W probably damaging Het
Tbc1d1 T C 5: 64,496,937 (GRCm39) F864L probably damaging Het
Tmem8b C A 4: 43,674,444 (GRCm39) R243S probably damaging Het
Tnfrsf11a T A 1: 105,772,583 (GRCm39) C623* probably null Het
Tprg1l T C 4: 154,243,812 (GRCm39) N115D probably damaging Het
Ube2t C T 1: 134,895,538 (GRCm39) A4V possibly damaging Het
Vps41 G A 13: 19,026,465 (GRCm39) probably benign Het
Wdr17 C T 8: 55,149,303 (GRCm39) probably null Het
Wwc1 G A 11: 35,732,637 (GRCm39) Q1024* probably null Het
Zfand5 T A 19: 21,253,879 (GRCm39) N27K probably damaging Het
Zfp142 A T 1: 74,608,873 (GRCm39) C1641S probably damaging Het
Zfyve16 A G 13: 92,629,042 (GRCm39) I1465T probably damaging Het
Zswim1 G A 2: 164,667,947 (GRCm39) G400S probably benign Het
Zswim3 C T 2: 164,662,279 (GRCm39) A253V possibly damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 99,970,691 (GRCm39) missense probably benign 0.00
IGL01143:Spag17 APN 3 99,846,614 (GRCm39) missense probably benign 0.00
IGL01329:Spag17 APN 3 100,002,865 (GRCm39) missense probably benign 0.16
IGL01393:Spag17 APN 3 99,934,926 (GRCm39) missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100,016,824 (GRCm39) missense possibly damaging 0.65
IGL01705:Spag17 APN 3 99,930,046 (GRCm39) missense probably benign 0.01
IGL01928:Spag17 APN 3 99,847,390 (GRCm39) splice site probably benign
IGL01981:Spag17 APN 3 99,966,149 (GRCm39) missense probably benign 0.03
IGL02435:Spag17 APN 3 99,889,760 (GRCm39) missense possibly damaging 0.53
IGL02452:Spag17 APN 3 99,934,707 (GRCm39) missense probably benign 0.00
IGL02465:Spag17 APN 3 99,983,187 (GRCm39) missense probably damaging 0.96
IGL02615:Spag17 APN 3 99,979,401 (GRCm39) missense probably benign 0.09
IGL02751:Spag17 APN 3 99,918,110 (GRCm39) nonsense probably null
IGL02803:Spag17 APN 3 100,016,713 (GRCm39) missense probably benign
IGL02898:Spag17 APN 3 100,008,702 (GRCm39) missense probably benign 0.00
IGL03037:Spag17 APN 3 99,979,486 (GRCm39) splice site probably null
IGL03068:Spag17 APN 3 99,987,521 (GRCm39) missense probably benign 0.35
IGL03131:Spag17 APN 3 99,918,075 (GRCm39) missense possibly damaging 0.85
IGL03224:Spag17 APN 3 99,918,156 (GRCm39) missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 99,963,568 (GRCm39) small insertion probably benign
FR4342:Spag17 UTSW 3 99,963,565 (GRCm39) small insertion probably benign
FR4548:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,574 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,561 (GRCm39) small insertion probably benign
FR4737:Spag17 UTSW 3 99,963,573 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,571 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
N/A:Spag17 UTSW 3 99,889,570 (GRCm39) splice site probably benign
PIT4504001:Spag17 UTSW 3 100,010,426 (GRCm39) critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 99,920,527 (GRCm39) missense possibly damaging 0.53
R0107:Spag17 UTSW 3 99,958,103 (GRCm39) missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100,014,143 (GRCm39) missense probably benign 0.08
R0243:Spag17 UTSW 3 99,992,684 (GRCm39) missense probably benign 0.04
R0375:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R0417:Spag17 UTSW 3 99,972,870 (GRCm39) missense probably benign 0.11
R0490:Spag17 UTSW 3 99,889,727 (GRCm39) missense probably damaging 0.97
R0537:Spag17 UTSW 3 100,032,618 (GRCm39) missense probably damaging 0.98
R0714:Spag17 UTSW 3 99,987,472 (GRCm39) missense probably damaging 0.97
R0844:Spag17 UTSW 3 99,912,101 (GRCm39) missense probably benign
R0919:Spag17 UTSW 3 99,979,259 (GRCm39) splice site probably benign
R0926:Spag17 UTSW 3 99,979,432 (GRCm39) missense probably benign
R1037:Spag17 UTSW 3 100,010,433 (GRCm39) missense probably benign 0.01
R1075:Spag17 UTSW 3 100,000,992 (GRCm39) missense probably damaging 0.99
R1109:Spag17 UTSW 3 99,934,667 (GRCm39) missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100,002,954 (GRCm39) missense probably benign 0.01
R1221:Spag17 UTSW 3 99,889,584 (GRCm39) missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99,846,679 (GRCm39) missense possibly damaging 0.73
R1586:Spag17 UTSW 3 99,929,068 (GRCm39) missense possibly damaging 0.53
R1768:Spag17 UTSW 3 99,934,668 (GRCm39) missense possibly damaging 0.53
R1782:Spag17 UTSW 3 99,918,070 (GRCm39) missense probably benign 0.02
R1789:Spag17 UTSW 3 99,846,672 (GRCm39) missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99,847,298 (GRCm39) missense probably benign
R2065:Spag17 UTSW 3 99,920,524 (GRCm39) missense probably benign 0.03
R2118:Spag17 UTSW 3 99,956,556 (GRCm39) missense possibly damaging 0.72
R2265:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2266:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2267:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2268:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2271:Spag17 UTSW 3 100,014,113 (GRCm39) missense probably damaging 1.00
R2389:Spag17 UTSW 3 100,014,153 (GRCm39) missense probably benign 0.27
R2420:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2422:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2423:Spag17 UTSW 3 100,010,772 (GRCm39) missense probably benign
R3407:Spag17 UTSW 3 99,992,615 (GRCm39) missense probably benign 0.09
R3801:Spag17 UTSW 3 99,961,169 (GRCm39) missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100,014,075 (GRCm39) missense probably damaging 1.00
R4021:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4022:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4408:Spag17 UTSW 3 100,010,694 (GRCm39) missense probably benign
R4468:Spag17 UTSW 3 99,992,682 (GRCm39) missense probably damaging 0.98
R4540:Spag17 UTSW 3 99,995,697 (GRCm39) missense probably damaging 1.00
R4621:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4622:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4756:Spag17 UTSW 3 100,010,701 (GRCm39) missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99,891,795 (GRCm39) missense possibly damaging 0.70
R4855:Spag17 UTSW 3 99,970,649 (GRCm39) missense probably benign 0.02
R4887:Spag17 UTSW 3 99,958,147 (GRCm39) missense probably damaging 1.00
R4962:Spag17 UTSW 3 99,934,939 (GRCm39) missense probably benign
R5030:Spag17 UTSW 3 99,992,657 (GRCm39) nonsense probably null
R5042:Spag17 UTSW 3 99,979,465 (GRCm39) missense probably damaging 1.00
R5074:Spag17 UTSW 3 99,987,434 (GRCm39) missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100,008,704 (GRCm39) missense probably benign 0.16
R5200:Spag17 UTSW 3 99,970,787 (GRCm39) nonsense probably null
R5267:Spag17 UTSW 3 99,969,264 (GRCm39) missense probably damaging 0.98
R5360:Spag17 UTSW 3 100,016,726 (GRCm39) missense probably benign 0.00
R5444:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5498:Spag17 UTSW 3 100,010,661 (GRCm39) missense possibly damaging 0.83
R5503:Spag17 UTSW 3 99,934,560 (GRCm39) missense possibly damaging 0.72
R5540:Spag17 UTSW 3 99,963,588 (GRCm39) missense possibly damaging 0.91
R5547:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5575:Spag17 UTSW 3 99,961,138 (GRCm39) missense possibly damaging 0.85
R5629:Spag17 UTSW 3 99,987,435 (GRCm39) missense probably benign 0.33
R5639:Spag17 UTSW 3 99,963,482 (GRCm39) missense probably damaging 1.00
R5842:Spag17 UTSW 3 99,846,566 (GRCm39) missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100,003,107 (GRCm39) nonsense probably null
R6082:Spag17 UTSW 3 100,031,501 (GRCm39) missense possibly damaging 0.46
R6228:Spag17 UTSW 3 99,929,918 (GRCm39) missense probably benign 0.33
R6254:Spag17 UTSW 3 99,972,901 (GRCm39) missense probably benign 0.03
R6321:Spag17 UTSW 3 99,995,743 (GRCm39) missense probably benign 0.05
R6446:Spag17 UTSW 3 100,010,448 (GRCm39) missense probably benign
R6687:Spag17 UTSW 3 100,000,266 (GRCm39) missense probably benign 0.07
R6853:Spag17 UTSW 3 99,920,551 (GRCm39) missense possibly damaging 0.86
R6946:Spag17 UTSW 3 99,911,999 (GRCm39) missense possibly damaging 0.53
R6953:Spag17 UTSW 3 99,942,291 (GRCm39) missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99,891,925 (GRCm39) missense probably benign 0.00
R7084:Spag17 UTSW 3 99,846,586 (GRCm39) missense probably benign 0.18
R7126:Spag17 UTSW 3 100,008,751 (GRCm39) missense probably benign 0.00
R7144:Spag17 UTSW 3 99,934,717 (GRCm39) splice site probably null
R7198:Spag17 UTSW 3 100,002,888 (GRCm39) missense probably benign 0.02
R7318:Spag17 UTSW 3 99,847,299 (GRCm39) missense probably benign 0.00
R7403:Spag17 UTSW 3 99,846,691 (GRCm39) missense possibly damaging 0.53
R7409:Spag17 UTSW 3 99,934,547 (GRCm39) missense possibly damaging 0.73
R7409:Spag17 UTSW 3 99,941,475 (GRCm39) missense probably benign 0.00
R7537:Spag17 UTSW 3 99,846,563 (GRCm39) missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100,002,911 (GRCm39) nonsense probably null
R7772:Spag17 UTSW 3 99,987,434 (GRCm39) missense probably damaging 0.98
R7842:Spag17 UTSW 3 99,961,174 (GRCm39) missense probably benign 0.18
R7963:Spag17 UTSW 3 99,929,954 (GRCm39) missense probably benign 0.02
R8168:Spag17 UTSW 3 99,942,300 (GRCm39) missense possibly damaging 0.96
R8291:Spag17 UTSW 3 99,968,166 (GRCm39) missense probably benign
R8347:Spag17 UTSW 3 99,934,957 (GRCm39) missense probably benign
R8383:Spag17 UTSW 3 99,992,708 (GRCm39) missense probably damaging 0.98
R8474:Spag17 UTSW 3 99,934,586 (GRCm39) missense probably benign 0.00
R8528:Spag17 UTSW 3 100,031,501 (GRCm39) missense possibly damaging 0.46
R8804:Spag17 UTSW 3 99,874,506 (GRCm39) missense probably benign
R8809:Spag17 UTSW 3 99,889,738 (GRCm39) missense probably benign 0.33
R8818:Spag17 UTSW 3 99,920,543 (GRCm39) missense probably benign 0.02
R8830:Spag17 UTSW 3 100,032,751 (GRCm39) missense possibly damaging 0.77
R8890:Spag17 UTSW 3 99,911,994 (GRCm39) missense possibly damaging 0.73
R9008:Spag17 UTSW 3 99,934,942 (GRCm39) missense possibly damaging 0.73
R9095:Spag17 UTSW 3 99,912,092 (GRCm39) missense possibly damaging 0.86
R9143:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R9182:Spag17 UTSW 3 99,966,158 (GRCm39) missense possibly damaging 0.92
R9211:Spag17 UTSW 3 100,032,614 (GRCm39) critical splice acceptor site probably benign
R9344:Spag17 UTSW 3 100,010,793 (GRCm39) missense probably benign 0.01
R9354:Spag17 UTSW 3 99,934,905 (GRCm39) missense probably benign
R9527:Spag17 UTSW 3 99,970,777 (GRCm39) missense probably damaging 1.00
R9658:Spag17 UTSW 3 99,934,932 (GRCm39) missense possibly damaging 0.93
R9738:Spag17 UTSW 3 99,934,526 (GRCm39) missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100,008,767 (GRCm39) missense probably benign 0.31
Z1088:Spag17 UTSW 3 100,002,946 (GRCm39) missense probably benign 0.09
Z1176:Spag17 UTSW 3 99,920,309 (GRCm39) missense probably benign 0.18
Z1177:Spag17 UTSW 3 99,995,715 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTTTCATGTGTCAACAATGCCC -3'
(R):5'- TGCTTACCCGCTGTCATTAAGACAAC -3'

Sequencing Primer
(F):5'- TGTGTCAACAATGCCCTGGAG -3'
(R):5'- CGCTGTCATTAAGACAACAGATGTG -3'
Posted On 2013-05-09