Incidental Mutation 'R4726:Megf10'
ID 358503
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms LOC240312, 3000002B06Rik
MMRRC Submission 041989-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R4726 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 57266162-57430539 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57420864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 834 (I834T)
Ref Sequence ENSEMBL: ENSMUSP00000116814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably benign
Transcript: ENSMUST00000075770
AA Change: I834T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: I834T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139892
AA Change: I834T

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: I834T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Meta Mutation Damage Score 0.1484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T C 17: 65,141,448 (GRCm39) S52G probably null Het
Abcc2 T C 19: 43,820,553 (GRCm39) S1351P probably benign Het
Acp2 T A 2: 91,034,622 (GRCm39) L87Q probably damaging Het
Adgrl3 C A 5: 81,794,425 (GRCm39) T550K possibly damaging Het
Amotl2 A G 9: 102,601,018 (GRCm39) R329G probably benign Het
Angel1 T C 12: 86,768,649 (GRCm39) N278S probably damaging Het
Ankrd12 A C 17: 66,277,319 (GRCm39) M1985R probably damaging Het
Apob T A 12: 8,040,267 (GRCm39) F535I probably damaging Het
Art3 A G 5: 92,559,002 (GRCm39) K313R probably benign Het
Asxl2 C T 12: 3,551,872 (GRCm39) H1205Y possibly damaging Het
Bsph1 A T 7: 13,206,920 (GRCm39) M99L probably benign Het
Ccdc153 T C 9: 44,154,963 (GRCm39) probably null Het
Cdh16 A T 8: 105,342,664 (GRCm39) M28K probably damaging Het
Cdhr2 T C 13: 54,866,352 (GRCm39) F353L probably damaging Het
Chrna2 G T 14: 66,386,345 (GRCm39) V164L possibly damaging Het
Cip2a A G 16: 48,834,433 (GRCm39) T672A probably benign Het
Ckmt1 T C 2: 121,191,712 (GRCm39) probably null Het
Col25a1 A T 3: 130,313,430 (GRCm39) E280V possibly damaging Het
Dnajc12 A G 10: 63,233,087 (GRCm39) D76G probably damaging Het
Drd3 G T 16: 43,643,164 (GRCm39) E467* probably null Het
Ecpas A G 4: 58,844,191 (GRCm39) V525A probably damaging Het
Ehbp1l1 C A 19: 5,769,204 (GRCm39) A700S possibly damaging Het
Gab1 T C 8: 81,515,682 (GRCm39) D212G possibly damaging Het
Gm26996 A G 6: 130,557,134 (GRCm39) noncoding transcript Het
Gm28113 A G 15: 75,198,577 (GRCm39) noncoding transcript Het
Has3 T C 8: 107,604,718 (GRCm39) F308S probably damaging Het
Ifit3b T A 19: 34,588,860 (GRCm39) I12N probably benign Het
Ifna4 C A 4: 88,760,519 (GRCm39) T141K probably benign Het
Ints3 A G 3: 90,301,084 (GRCm39) S840P probably damaging Het
Itih4 T C 14: 30,611,792 (GRCm39) V132A probably damaging Het
Itprid2 T A 2: 79,493,101 (GRCm39) I1216N probably damaging Het
Kcnj10 A G 1: 172,196,639 (GRCm39) Y51C probably damaging Het
Klk1b24 G A 7: 43,839,820 (GRCm39) V60I probably damaging Het
Klra14-ps C A 6: 130,134,626 (GRCm39) noncoding transcript Het
Krt6b A G 15: 101,586,520 (GRCm39) I323T probably damaging Het
Lilra5 A C 7: 4,240,957 (GRCm39) Q17P probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Map3k4 T C 17: 12,451,851 (GRCm39) N1479S possibly damaging Het
Mbd3l2 A T 9: 18,356,256 (GRCm39) I194F probably damaging Het
Mterf4 G A 1: 93,229,471 (GRCm39) T251M probably damaging Het
Mtmr3 A T 11: 4,457,634 (GRCm39) D170E probably damaging Het
Myom3 C T 4: 135,534,586 (GRCm39) probably null Het
Nemp1 G A 10: 127,530,462 (GRCm39) V305I probably benign Het
Nlrp1b G T 11: 71,072,232 (GRCm39) T537K probably benign Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Or5b3 T A 19: 13,388,469 (GRCm39) C179S probably damaging Het
Or6c206 A G 10: 129,097,045 (GRCm39) T72A possibly damaging Het
Or8k28 A G 2: 86,286,580 (GRCm39) F12L possibly damaging Het
Pias1 A G 9: 62,827,771 (GRCm39) V212A probably damaging Het
Plscr1 T A 9: 92,145,221 (GRCm39) V77D probably damaging Het
Plxna1 T C 6: 89,299,798 (GRCm39) N1657S probably damaging Het
Ptprf A G 4: 118,069,414 (GRCm39) V1551A possibly damaging Het
Ptprn2 C A 12: 117,211,393 (GRCm39) Y857* probably null Het
Puf60 A T 15: 75,944,183 (GRCm39) probably null Het
Rnf20 C T 4: 49,654,579 (GRCm39) R879* probably null Het
Robo1 G A 16: 72,768,931 (GRCm39) A499T probably damaging Het
Slc39a14 A G 14: 70,551,048 (GRCm39) probably null Het
Smarcad1 A T 6: 65,052,025 (GRCm39) H6L probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Stk39 T A 2: 68,093,647 (GRCm39) D488V probably damaging Het
Stx19 A G 16: 62,642,495 (GRCm39) N104D probably benign Het
Tcstv1b A T 13: 120,635,173 (GRCm39) S152C possibly damaging Het
Tmem222 T C 4: 133,004,975 (GRCm39) M21V probably benign Het
Trim43b T A 9: 88,971,538 (GRCm39) N205I possibly damaging Het
Ubr4 C A 4: 139,209,890 (GRCm39) H5017N possibly damaging Het
Vmn2r93 A G 17: 18,536,960 (GRCm39) T548A probably damaging Het
Vps8 G A 16: 21,267,154 (GRCm39) probably null Het
Wasl A G 6: 24,633,110 (GRCm39) V176A probably benign Het
Wbp2nl T A 15: 82,190,255 (GRCm39) V61E probably damaging Het
Zfp959 T A 17: 56,205,260 (GRCm39) probably null Het
Zmiz1 T C 14: 25,644,098 (GRCm39) probably null Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57,373,700 (GRCm39) missense probably damaging 1.00
IGL00736:Megf10 APN 18 57,425,782 (GRCm39) missense probably benign 0.35
IGL01631:Megf10 APN 18 57,392,869 (GRCm39) missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57,425,704 (GRCm39) missense probably damaging 1.00
IGL02747:Megf10 APN 18 57,423,565 (GRCm39) missense probably benign 0.43
IGL03298:Megf10 APN 18 57,416,910 (GRCm39) nonsense probably null
deep UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
megalodon UTSW 18 57,421,048 (GRCm39) nonsense probably null
sharkie UTSW 18 57,324,257 (GRCm39) nonsense probably null
IGL03046:Megf10 UTSW 18 57,421,055 (GRCm39) missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57,410,760 (GRCm39) missense probably damaging 1.00
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57,392,874 (GRCm39) missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57,386,054 (GRCm39) missense probably benign 0.34
R0602:Megf10 UTSW 18 57,395,172 (GRCm39) missense probably damaging 0.98
R0630:Megf10 UTSW 18 57,421,067 (GRCm39) missense probably benign 0.14
R0652:Megf10 UTSW 18 57,410,796 (GRCm39) missense probably benign 0.00
R0658:Megf10 UTSW 18 57,385,968 (GRCm39) missense probably benign 0.00
R0761:Megf10 UTSW 18 57,421,048 (GRCm39) nonsense probably null
R1013:Megf10 UTSW 18 57,394,291 (GRCm39) missense probably benign 0.00
R1130:Megf10 UTSW 18 57,395,078 (GRCm39) missense probably benign 0.06
R1451:Megf10 UTSW 18 57,385,931 (GRCm39) missense probably damaging 0.97
R1699:Megf10 UTSW 18 57,410,802 (GRCm39) splice site probably null
R1729:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1784:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1870:Megf10 UTSW 18 57,324,257 (GRCm39) nonsense probably null
R1961:Megf10 UTSW 18 57,345,426 (GRCm39) missense probably damaging 0.97
R2094:Megf10 UTSW 18 57,414,785 (GRCm39) nonsense probably null
R2213:Megf10 UTSW 18 57,421,081 (GRCm39) nonsense probably null
R2853:Megf10 UTSW 18 57,427,003 (GRCm39) missense probably damaging 1.00
R3772:Megf10 UTSW 18 57,416,934 (GRCm39) missense probably benign 0.39
R3774:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3775:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3776:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3858:Megf10 UTSW 18 57,408,907 (GRCm39) splice site probably benign
R3911:Megf10 UTSW 18 57,422,465 (GRCm39) missense probably damaging 0.99
R3966:Megf10 UTSW 18 57,313,646 (GRCm39) missense probably damaging 1.00
R4043:Megf10 UTSW 18 57,392,870 (GRCm39) missense probably damaging 0.98
R4131:Megf10 UTSW 18 57,313,607 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,420,884 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,322,675 (GRCm39) critical splice donor site probably null
R4765:Megf10 UTSW 18 57,420,866 (GRCm39) missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57,426,930 (GRCm39) missense probably benign 0.00
R4928:Megf10 UTSW 18 57,373,745 (GRCm39) missense probably benign
R5412:Megf10 UTSW 18 57,324,219 (GRCm39) missense probably damaging 0.99
R5901:Megf10 UTSW 18 57,410,180 (GRCm39) missense probably benign 0.11
R6015:Megf10 UTSW 18 57,386,100 (GRCm39) missense probably benign 0.01
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6041:Megf10 UTSW 18 57,313,621 (GRCm39) missense probably benign
R6369:Megf10 UTSW 18 57,394,259 (GRCm39) missense probably benign 0.06
R6479:Megf10 UTSW 18 57,379,642 (GRCm39) missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57,424,879 (GRCm39) missense probably benign 0.01
R7228:Megf10 UTSW 18 57,322,661 (GRCm39) missense probably damaging 1.00
R7296:Megf10 UTSW 18 57,408,825 (GRCm39) missense probably damaging 1.00
R7437:Megf10 UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
R7461:Megf10 UTSW 18 57,385,925 (GRCm39) missense probably damaging 0.98
R7488:Megf10 UTSW 18 57,324,187 (GRCm39) missense probably damaging 0.99
R7492:Megf10 UTSW 18 57,424,866 (GRCm39) missense probably benign 0.00
R7542:Megf10 UTSW 18 57,322,642 (GRCm39) missense probably benign 0.07
R7636:Megf10 UTSW 18 57,410,061 (GRCm39) missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7650:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7713:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7714:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7716:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7796:Megf10 UTSW 18 57,410,731 (GRCm39) missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57,373,807 (GRCm39) missense probably benign 0.05
R8221:Megf10 UTSW 18 57,416,893 (GRCm39) missense probably benign 0.00
R8527:Megf10 UTSW 18 57,425,790 (GRCm39) missense probably benign 0.00
R8559:Megf10 UTSW 18 57,373,699 (GRCm39) missense probably damaging 1.00
R9117:Megf10 UTSW 18 57,392,773 (GRCm39) missense probably damaging 1.00
R9337:Megf10 UTSW 18 57,394,252 (GRCm39) nonsense probably null
R9481:Megf10 UTSW 18 57,395,090 (GRCm39) missense probably benign 0.38
R9644:Megf10 UTSW 18 57,375,773 (GRCm39) missense probably benign
RF003:Megf10 UTSW 18 57,427,099 (GRCm39) unclassified probably benign
Z1176:Megf10 UTSW 18 57,410,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCTTTGAAAGTGGAGAGTGTCTG -3'
(R):5'- GCATTGATGACCCTCATGGC -3'

Sequencing Primer
(F):5'- GAGAGTGTCTGCTTTCACCATGC -3'
(R):5'- TAGGTCACGGCCGGCATG -3'
Posted On 2015-11-11