Incidental Mutation 'R4726:Ehbp1l1'
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene NameEH domain binding protein 1-like 1
MMRRC Submission 041989-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4726 (G1)
Quality Score225
Status Validated
Chromosomal Location5707376-5726317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5719176 bp
Amino Acid Change Alanine to Serine at position 700 (A700S)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049295
AA Change: A700S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: A700S

Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T C 17: 64,834,453 S52G probably null Het
Abcc2 T C 19: 43,832,114 S1351P probably benign Het
Acp2 T A 2: 91,204,277 L87Q probably damaging Het
Adgrl3 C A 5: 81,646,578 T550K possibly damaging Het
AI314180 A G 4: 58,844,191 V525A probably damaging Het
Amotl2 A G 9: 102,723,819 R329G probably benign Het
Angel1 T C 12: 86,721,875 N278S probably damaging Het
Ankrd12 A C 17: 65,970,324 M1985R probably damaging Het
Apob T A 12: 7,990,267 F535I probably damaging Het
Art3 A G 5: 92,411,143 K313R probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Bsph1 A T 7: 13,472,995 M99L probably benign Het
C330027C09Rik A G 16: 49,014,070 T672A probably benign Het
Ccdc153 T C 9: 44,243,666 probably null Het
Cdh16 A T 8: 104,616,032 M28K probably damaging Het
Cdhr2 T C 13: 54,718,539 F353L probably damaging Het
Chrna2 G T 14: 66,148,896 V164L possibly damaging Het
Ckmt1 T C 2: 121,361,231 probably null Het
Col25a1 A T 3: 130,519,781 E280V possibly damaging Het
Dnajc12 A G 10: 63,397,308 D76G probably damaging Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Gab1 T C 8: 80,789,053 D212G possibly damaging Het
Gm21818 A T 13: 120,173,637 S152C possibly damaging Het
Gm26996 A G 6: 130,580,171 noncoding transcript Het
Gm28113 A G 15: 75,326,728 noncoding transcript Het
Has3 T C 8: 106,878,086 F308S probably damaging Het
Ifit3b T A 19: 34,611,460 I12N probably benign Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ints3 A G 3: 90,393,777 S840P probably damaging Het
Itih4 T C 14: 30,889,835 V132A probably damaging Het
Kcnj10 A G 1: 172,369,072 Y51C probably damaging Het
Klk1b24 G A 7: 44,190,396 V60I probably damaging Het
Klra14-ps C A 6: 130,157,663 noncoding transcript Het
Krt6b A G 15: 101,678,085 I323T probably damaging Het
Lilra5 A C 7: 4,237,958 Q17P probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k4 T C 17: 12,232,964 N1479S possibly damaging Het
Mbd3l2 A T 9: 18,444,960 I194F probably damaging Het
Megf10 T C 18: 57,287,792 I834T probably benign Het
Mterf4 G A 1: 93,301,749 T251M probably damaging Het
Mtmr3 A T 11: 4,507,634 D170E probably damaging Het
Myom3 C T 4: 135,807,275 probably null Het
Nemp1 G A 10: 127,694,593 V305I probably benign Het
Nlrp1b G T 11: 71,181,406 T537K probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1066 A G 2: 86,456,236 F12L possibly damaging Het
Olfr1469 T A 19: 13,411,105 C179S probably damaging Het
Olfr776 A G 10: 129,261,176 T72A possibly damaging Het
Pias1 A G 9: 62,920,489 V212A probably damaging Het
Plscr1 T A 9: 92,263,168 V77D probably damaging Het
Plxna1 T C 6: 89,322,816 N1657S probably damaging Het
Ptprf A G 4: 118,212,217 V1551A possibly damaging Het
Ptprn2 C A 12: 117,247,773 Y857* probably null Het
Puf60 A T 15: 76,072,334 probably null Het
Rnf20 C T 4: 49,654,579 R879* probably null Het
Robo1 G A 16: 72,972,043 A499T probably damaging Het
Slc39a14 A G 14: 70,313,599 probably null Het
Smarcad1 A T 6: 65,075,041 H6L probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Ssfa2 T A 2: 79,662,757 I1216N probably damaging Het
Stk39 T A 2: 68,263,303 D488V probably damaging Het
Stx19 A G 16: 62,822,132 N104D probably benign Het
Tmem222 T C 4: 133,277,664 M21V probably benign Het
Trim43b T A 9: 89,089,485 N205I possibly damaging Het
Ubr4 C A 4: 139,482,579 H5017N possibly damaging Het
Vmn2r93 A G 17: 18,316,698 T548A probably damaging Het
Vps8 G A 16: 21,448,404 probably null Het
Wasl A G 6: 24,633,111 V176A probably benign Het
Wbp2nl T A 15: 82,306,054 V61E probably damaging Het
Zfp959 T A 17: 55,898,260 probably null Het
Zmiz1 T C 14: 25,643,674 probably null Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5717933 missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5717888 missense probably benign
IGL01372:Ehbp1l1 APN 19 5715789 splice site probably benign
IGL01790:Ehbp1l1 APN 19 5722984 missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5718249 nonsense probably null
IGL02194:Ehbp1l1 APN 19 5718857 missense probably benign
IGL02347:Ehbp1l1 APN 19 5719572 missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5710834 missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5720825 missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5719298 missense probably benign
IGL03070:Ehbp1l1 APN 19 5715953 missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5720033 missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5719575 missense possibly damaging 0.93
R0309:Ehbp1l1 UTSW 19 5720570 missense possibly damaging 0.72
R0787:Ehbp1l1 UTSW 19 5722668 missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5708336 unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5718230 missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5719084 missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5716424 missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5721967 missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5716406 missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5717691 missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5725930 missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5717854 missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5710669 missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5719283 missense probably benign
R2098:Ehbp1l1 UTSW 19 5708658 missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5718401 missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5716487 missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5718980 missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5719115 missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5718312 missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5708769 missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5716293 missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5717927 missense possibly damaging 0.72
R4761:Ehbp1l1 UTSW 19 5719847 missense possibly damaging 0.93
R4771:Ehbp1l1 UTSW 19 5725968 missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5716320 missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R5602:Ehbp1l1 UTSW 19 5708670 missense possibly damaging 0.85
R5893:Ehbp1l1 UTSW 19 5718431 missense probably benign
R6329:Ehbp1l1 UTSW 19 5718767 missense possibly damaging 0.53
R6416:Ehbp1l1 UTSW 19 5718757 missense probably benign 0.01
R7106:Ehbp1l1 UTSW 19 5718737 missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5718446 nonsense probably null
R7304:Ehbp1l1 UTSW 19 5716382 missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5720702 missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5720844 missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5719428 missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5720823 missense probably benign
R7881:Ehbp1l1 UTSW 19 5719398 missense probably benign
R7910:Ehbp1l1 UTSW 19 5716424 missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5720061 missense possibly damaging 0.53
R8309:Ehbp1l1 UTSW 19 5717075 missense probably damaging 1.00
R8324:Ehbp1l1 UTSW 19 5719998 missense possibly damaging 0.86
R8724:Ehbp1l1 UTSW 19 5715858 missense possibly damaging 0.73
RF053:Ehbp1l1 UTSW 19 5716002 small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5716287 missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5717889 missense probably benign
Z1177:Ehbp1l1 UTSW 19 5718762 missense probably damaging 0.99
Z1177:Ehbp1l1 UTSW 19 5719101 missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5719102 missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5719434 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-11-11