Incidental Mutation 'R4726:Abcc2'
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonymsmultidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission 041989-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4726 (G1)
Quality Score225
Status Validated
Chromosomal Location43782192-43840740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43832114 bp
Amino Acid Change Serine to Proline at position 1351 (S1351P)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
Predicted Effect probably benign
Transcript: ENSMUST00000026208
AA Change: S1351P

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: S1351P

transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T C 17: 64,834,453 S52G probably null Het
Acp2 T A 2: 91,204,277 L87Q probably damaging Het
Adgrl3 C A 5: 81,646,578 T550K possibly damaging Het
AI314180 A G 4: 58,844,191 V525A probably damaging Het
Amotl2 A G 9: 102,723,819 R329G probably benign Het
Angel1 T C 12: 86,721,875 N278S probably damaging Het
Ankrd12 A C 17: 65,970,324 M1985R probably damaging Het
Apob T A 12: 7,990,267 F535I probably damaging Het
Art3 A G 5: 92,411,143 K313R probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Bsph1 A T 7: 13,472,995 M99L probably benign Het
C330027C09Rik A G 16: 49,014,070 T672A probably benign Het
Ccdc153 T C 9: 44,243,666 probably null Het
Cdh16 A T 8: 104,616,032 M28K probably damaging Het
Cdhr2 T C 13: 54,718,539 F353L probably damaging Het
Chrna2 G T 14: 66,148,896 V164L possibly damaging Het
Ckmt1 T C 2: 121,361,231 probably null Het
Col25a1 A T 3: 130,519,781 E280V possibly damaging Het
Dnajc12 A G 10: 63,397,308 D76G probably damaging Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Ehbp1l1 C A 19: 5,719,176 A700S possibly damaging Het
Gab1 T C 8: 80,789,053 D212G possibly damaging Het
Gm21818 A T 13: 120,173,637 S152C possibly damaging Het
Gm26996 A G 6: 130,580,171 noncoding transcript Het
Gm28113 A G 15: 75,326,728 noncoding transcript Het
Has3 T C 8: 106,878,086 F308S probably damaging Het
Ifit3b T A 19: 34,611,460 I12N probably benign Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ints3 A G 3: 90,393,777 S840P probably damaging Het
Itih4 T C 14: 30,889,835 V132A probably damaging Het
Kcnj10 A G 1: 172,369,072 Y51C probably damaging Het
Klk1b24 G A 7: 44,190,396 V60I probably damaging Het
Klra14-ps C A 6: 130,157,663 noncoding transcript Het
Krt6b A G 15: 101,678,085 I323T probably damaging Het
Lilra5 A C 7: 4,237,958 Q17P probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k4 T C 17: 12,232,964 N1479S possibly damaging Het
Mbd3l2 A T 9: 18,444,960 I194F probably damaging Het
Megf10 T C 18: 57,287,792 I834T probably benign Het
Mterf4 G A 1: 93,301,749 T251M probably damaging Het
Mtmr3 A T 11: 4,507,634 D170E probably damaging Het
Myom3 C T 4: 135,807,275 probably null Het
Nemp1 G A 10: 127,694,593 V305I probably benign Het
Nlrp1b G T 11: 71,181,406 T537K probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1066 A G 2: 86,456,236 F12L possibly damaging Het
Olfr1469 T A 19: 13,411,105 C179S probably damaging Het
Olfr776 A G 10: 129,261,176 T72A possibly damaging Het
Pias1 A G 9: 62,920,489 V212A probably damaging Het
Plscr1 T A 9: 92,263,168 V77D probably damaging Het
Plxna1 T C 6: 89,322,816 N1657S probably damaging Het
Ptprf A G 4: 118,212,217 V1551A possibly damaging Het
Ptprn2 C A 12: 117,247,773 Y857* probably null Het
Puf60 A T 15: 76,072,334 probably null Het
Rnf20 C T 4: 49,654,579 R879* probably null Het
Robo1 G A 16: 72,972,043 A499T probably damaging Het
Slc39a14 A G 14: 70,313,599 probably null Het
Smarcad1 A T 6: 65,075,041 H6L probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Ssfa2 T A 2: 79,662,757 I1216N probably damaging Het
Stk39 T A 2: 68,263,303 D488V probably damaging Het
Stx19 A G 16: 62,822,132 N104D probably benign Het
Tmem222 T C 4: 133,277,664 M21V probably benign Het
Trim43b T A 9: 89,089,485 N205I possibly damaging Het
Ubr4 C A 4: 139,482,579 H5017N possibly damaging Het
Vmn2r93 A G 17: 18,316,698 T548A probably damaging Het
Vps8 G A 16: 21,448,404 probably null Het
Wasl A G 6: 24,633,111 V176A probably benign Het
Wbp2nl T A 15: 82,306,054 V61E probably damaging Het
Zfp959 T A 17: 55,898,260 probably null Het
Zmiz1 T C 14: 25,643,674 probably null Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 splice site probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 splice site probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7919:Abcc2 UTSW 19 43816809 missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R7993:Abcc2 UTSW 19 43814792 missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43804971 missense probably benign 0.07
R8693:Abcc2 UTSW 19 43822035 missense probably benign 0.06
R8722:Abcc2 UTSW 19 43836613 missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43782416 missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43808666 missense probably benign 0.01
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-11-11