Incidental Mutation 'R4727:Cacna1e'
ID358512
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Namecalcium channel, voltage-dependent, R type, alpha 1E subunit
SynonymsCchra1, alpha1E, Cav2.3
MMRRC Submission 041602-MU
Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R4727 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location154390731-154884501 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 154436468 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1530 (Q1530*)
Ref Sequence ENSEMBL: ENSMUSP00000148507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
Predicted Effect probably null
Transcript: ENSMUST00000004214
AA Change: Q1284*
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: Q1284*

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187541
AA Change: Q1592*
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: Q1592*

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211821
AA Change: Q1530*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,178,286 N483S probably benign Het
Acoxl T G 2: 127,978,738 L70R probably damaging Het
Ankrd44 A T 1: 54,667,417 F627I probably benign Het
Ash2l A T 8: 25,818,595 I552N probably damaging Het
B4galt1 A G 4: 40,807,812 S330P probably damaging Het
Bnip3 T C 7: 138,898,706 S52G probably damaging Het
Btd A G 14: 31,662,321 Q88R probably benign Het
C4bp A G 1: 130,639,185 V318A probably benign Het
Calm1 T C 12: 100,200,226 F23S probably benign Het
Cep290 T G 10: 100,563,270 I2218R probably benign Het
Ces2c T C 8: 104,848,040 I43T probably benign Het
Cyp2d9 T C 15: 82,454,401 L1P probably null Het
Dgki C A 6: 37,299,813 probably benign Het
Dhh A G 15: 98,898,142 L44P probably damaging Het
Dnah12 A G 14: 26,872,317 I3409V probably damaging Het
Dnah7b G A 1: 46,207,656 R1664H probably damaging Het
Dnah8 T C 17: 30,851,747 M4469T probably damaging Het
Ehhadh T C 16: 21,762,431 I604V probably benign Het
Esr1 A G 10: 5,001,418 I599V probably benign Het
Faf1 G A 4: 109,840,367 D297N probably damaging Het
Gfra1 A T 19: 58,263,954 N380K probably damaging Het
Ghitm A G 14: 37,133,743 C8R probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Itsn2 A G 12: 4,707,660 Y1424C probably damaging Het
Kcnj10 A G 1: 172,369,699 D260G probably damaging Het
Klf16 T C 10: 80,569,186 D164G probably damaging Het
Klhdc7b T A 15: 89,387,582 L889Q probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Lrp11 A G 10: 7,590,584 E153G probably benign Het
Lrrc43 A T 5: 123,494,303 T170S probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Man1a A T 10: 53,907,572 probably null Het
Mmp24 C T 2: 155,815,899 P570S possibly damaging Het
Ms4a3 A G 19: 11,631,378 M170T probably damaging Het
Naip5 C A 13: 100,221,870 A953S possibly damaging Het
Nfrkb T C 9: 31,403,623 S580P probably damaging Het
Olfr638 T G 7: 104,003,890 V205G probably benign Het
Olfr885 T C 9: 38,062,093 Y258H probably damaging Het
Padi6 T G 4: 140,731,195 D462A probably damaging Het
Pde6a A G 18: 61,231,489 R206G probably benign Het
Plk4 A G 3: 40,805,154 N162D probably benign Het
Ptpn13 T A 5: 103,569,855 D1922E probably benign Het
Rangap1 G A 15: 81,729,755 probably benign Het
Rapgef3 A G 15: 97,760,600 L175P probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Satb1 T C 17: 51,804,347 Y161C probably damaging Het
Sel1l3 C A 5: 53,144,183 probably null Het
Slc17a7 C T 7: 45,172,934 S398L possibly damaging Het
Slc22a4 T A 11: 54,027,651 E109V possibly damaging Het
Slc26a7 C T 4: 14,590,477 A105T probably damaging Het
Slc47a1 T C 11: 61,363,451 N145S possibly damaging Het
Tank A G 2: 61,653,532 T441A probably benign Het
Tefm T C 11: 80,140,453 probably benign Het
Ttbk2 T C 2: 120,745,370 Y1042C probably benign Het
Wdfy3 T C 5: 101,930,028 Q892R probably damaging Het
Wdr33 T A 18: 31,888,447 H683Q unknown Het
Zfp36l2 T A 17: 84,187,661 I12F probably benign Het
Zfyve26 A T 12: 79,244,396 M2145K probably benign Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154403683 missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154471601 missense probably benign 0.04
IGL01302:Cacna1e APN 1 154443907 missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154472377 missense probably benign 0.18
IGL01573:Cacna1e APN 1 154471367 missense probably benign
IGL01676:Cacna1e APN 1 154398476 missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154412450 missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154471373 missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154471340 missense probably null 0.00
IGL01895:Cacna1e APN 1 154443900 missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154421113 missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154403747 missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154426528 missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154493409 missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154445648 missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154465741 missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154471425 missense probably benign 0.15
IGL03120:Cacna1e APN 1 154443881 missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154493358 missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154442251 missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154466944 critical splice donor site probably null
bezoar UTSW 1 154436554 splice site probably null
hairball UTSW 1 154479305 missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154443901 missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154448947 splice site probably null
R0314:Cacna1e UTSW 1 154442251 missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154416138 missense probably benign 0.03
R0626:Cacna1e UTSW 1 154488817 missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154442278 missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154444968 missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154398673 missense probably benign
R1340:Cacna1e UTSW 1 154472657 missense probably damaging 1.00
R1440:Cacna1e UTSW 1 154561806 missense possibly damaging 0.63
R1449:Cacna1e UTSW 1 154485662 critical splice donor site probably null
R1538:Cacna1e UTSW 1 154561758 missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154477779 missense probably benign 0.01
R1560:Cacna1e UTSW 1 154421104 nonsense probably null
R1748:Cacna1e UTSW 1 154486569 missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154444000 missense probably damaging 1.00
R1912:Cacna1e UTSW 1 154436449 missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154700494 missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154443845 missense probably damaging 1.00
R2291:Cacna1e UTSW 1 154403683 missense probably damaging 0.99
R2417:Cacna1e UTSW 1 154472193 missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154416085 missense probably benign 0.08
R3757:Cacna1e UTSW 1 154633696 missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154483553 missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154482585 missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154412183 splice site probably null
R4275:Cacna1e UTSW 1 154493325 missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154426550 missense probably benign 0.04
R4297:Cacna1e UTSW 1 154398731 missense probably benign 0.37
R4356:Cacna1e UTSW 1 154443981 missense probably damaging 1.00
R4510:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154402027 missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154436519 missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154471613 missense probably benign
R4622:Cacna1e UTSW 1 154471565 missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154482548 splice site probably null
R4694:Cacna1e UTSW 1 154437266 critical splice donor site probably null
R4839:Cacna1e UTSW 1 154421058 missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154436554 splice site probably null
R4894:Cacna1e UTSW 1 154488805 nonsense probably null
R4934:Cacna1e UTSW 1 154481634 nonsense probably null
R4979:Cacna1e UTSW 1 154413993 missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154561729 critical splice donor site probably null
R5128:Cacna1e UTSW 1 154402021 missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154701364 missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154700504 missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154477796 missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154465779 missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154443937 missense probably damaging 1.00
R5475:Cacna1e UTSW 1 154725709 missense possibly damaging 0.53
R5607:Cacna1e UTSW 1 154471340 missense probably benign 0.00
R5615:Cacna1e UTSW 1 154412170 missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154442194 missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154635858 missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154633717 missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154471637 missense probably benign 0.00
R5893:Cacna1e UTSW 1 154437323 missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154561791 missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154701291 missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154486570 missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6295:Cacna1e UTSW 1 154442173 missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6320:Cacna1e UTSW 1 154441524 missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154479305 missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154413974 critical splice donor site probably null
R6842:Cacna1e UTSW 1 154483117 missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154725693 missense probably null 0.85
R7081:Cacna1e UTSW 1 154700383 missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154473746 intron probably null
R7108:Cacna1e UTSW 1 154468995 frame shift probably null
R7142:Cacna1e UTSW 1 154412484 missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154700489 missense possibly damaging 0.93
R7332:Cacna1e UTSW 1 154725801 missense possibly damaging 0.89
R7410:Cacna1e UTSW 1 154472234 missense probably benign 0.13
R7502:Cacna1e UTSW 1 154468988 missense probably null 0.35
R7556:Cacna1e UTSW 1 154472673 missense probably benign 0.28
R7563:Cacna1e UTSW 1 154471416 missense probably benign 0.00
R7573:Cacna1e UTSW 1 154726165 intron probably benign
R7689:Cacna1e UTSW 1 154398803 missense probably benign 0.01
R7744:Cacna1e UTSW 1 154465792 missense probably damaging 1.00
R7754:Cacna1e UTSW 1 154413117 missense probably damaging 0.97
R7787:Cacna1e UTSW 1 154482568 missense probably damaging 0.98
R7818:Cacna1e UTSW 1 154398406 missense probably damaging 1.00
R7838:Cacna1e UTSW 1 154471403 missense probably benign 0.08
R7849:Cacna1e UTSW 1 154633718 missense probably damaging 1.00
R7921:Cacna1e UTSW 1 154471403 missense probably benign 0.08
R7932:Cacna1e UTSW 1 154633718 missense probably damaging 1.00
RF008:Cacna1e UTSW 1 154442136 missense probably damaging 1.00
X0062:Cacna1e UTSW 1 154412492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGCCTGCGCTATAATC -3'
(R):5'- TGCAAAAGACAGAGACTGCC -3'

Sequencing Primer
(F):5'- GCCTGCGCTATAATCAAGAACTATTG -3'
(R):5'- GACAGAGACTGCCATCTATTTTGTG -3'
Posted On2015-11-11