Incidental Mutation 'R4727:Kcnj10'
ID358513
Institutional Source Beutler Lab
Gene Symbol Kcnj10
Ensembl Gene ENSMUSG00000044708
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 10
SynonymsBIR10, Kir4.1, Kir1.2, Kir4.1, BIRK-1
MMRRC Submission 041602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4727 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172341210-172374085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172369699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 260 (D260G)
Ref Sequence ENSEMBL: ENSMUSP00000054356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056136]
Predicted Effect probably damaging
Transcript: ENSMUST00000056136
AA Change: D260G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054356
Gene: ENSMUSG00000044708
AA Change: D260G

DomainStartEndE-ValueType
Pfam:IRK 31 363 2.2e-136 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inward rectifier-type potassium channel family, characterized by having a greater tendency to allow potassium to flow into, rather than out of, a cell. The encoded protein may form a heterodimer with another potassium channel protein and may be responsible for the potassium buffering action of glial cells in the brain. Mutations in this gene have been associated with seizure susceptibility of common idiopathic generalized epilepsy syndromes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice show increased input resistance and high depolarization of retinal Muller cells, loss of the endocochlear potential, motor coordination deficits and hindlimb paralysis, and a hypomyelination and spongiform vacuolation in the spinalcord associated with severe axonal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,178,286 N483S probably benign Het
Acoxl T G 2: 127,978,738 L70R probably damaging Het
Ankrd44 A T 1: 54,667,417 F627I probably benign Het
Ash2l A T 8: 25,818,595 I552N probably damaging Het
B4galt1 A G 4: 40,807,812 S330P probably damaging Het
Bnip3 T C 7: 138,898,706 S52G probably damaging Het
Btd A G 14: 31,662,321 Q88R probably benign Het
C4bp A G 1: 130,639,185 V318A probably benign Het
Cacna1e G A 1: 154,436,468 Q1530* probably null Het
Calm1 T C 12: 100,200,226 F23S probably benign Het
Cep290 T G 10: 100,563,270 I2218R probably benign Het
Ces2c T C 8: 104,848,040 I43T probably benign Het
Cyp2d9 T C 15: 82,454,401 L1P probably null Het
Dgki C A 6: 37,299,813 probably benign Het
Dhh A G 15: 98,898,142 L44P probably damaging Het
Dnah12 A G 14: 26,872,317 I3409V probably damaging Het
Dnah7b G A 1: 46,207,656 R1664H probably damaging Het
Dnah8 T C 17: 30,851,747 M4469T probably damaging Het
Ehhadh T C 16: 21,762,431 I604V probably benign Het
Esr1 A G 10: 5,001,418 I599V probably benign Het
Faf1 G A 4: 109,840,367 D297N probably damaging Het
Gfra1 A T 19: 58,263,954 N380K probably damaging Het
Ghitm A G 14: 37,133,743 C8R probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Itsn2 A G 12: 4,707,660 Y1424C probably damaging Het
Klf16 T C 10: 80,569,186 D164G probably damaging Het
Klhdc7b T A 15: 89,387,582 L889Q probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Lrp11 A G 10: 7,590,584 E153G probably benign Het
Lrrc43 A T 5: 123,494,303 T170S probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Man1a A T 10: 53,907,572 probably null Het
Mmp24 C T 2: 155,815,899 P570S possibly damaging Het
Ms4a3 A G 19: 11,631,378 M170T probably damaging Het
Naip5 C A 13: 100,221,870 A953S possibly damaging Het
Nfrkb T C 9: 31,403,623 S580P probably damaging Het
Olfr638 T G 7: 104,003,890 V205G probably benign Het
Olfr885 T C 9: 38,062,093 Y258H probably damaging Het
Padi6 T G 4: 140,731,195 D462A probably damaging Het
Pde6a A G 18: 61,231,489 R206G probably benign Het
Plk4 A G 3: 40,805,154 N162D probably benign Het
Ptpn13 T A 5: 103,569,855 D1922E probably benign Het
Rangap1 G A 15: 81,729,755 probably benign Het
Rapgef3 A G 15: 97,760,600 L175P probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Satb1 T C 17: 51,804,347 Y161C probably damaging Het
Sel1l3 C A 5: 53,144,183 probably null Het
Slc17a7 C T 7: 45,172,934 S398L possibly damaging Het
Slc22a4 T A 11: 54,027,651 E109V possibly damaging Het
Slc26a7 C T 4: 14,590,477 A105T probably damaging Het
Slc47a1 T C 11: 61,363,451 N145S possibly damaging Het
Tank A G 2: 61,653,532 T441A probably benign Het
Tefm T C 11: 80,140,453 probably benign Het
Ttbk2 T C 2: 120,745,370 Y1042C probably benign Het
Wdfy3 T C 5: 101,930,028 Q892R probably damaging Het
Wdr33 T A 18: 31,888,447 H683Q unknown Het
Zfp36l2 T A 17: 84,187,661 I12F probably benign Het
Zfyve26 A T 12: 79,244,396 M2145K probably benign Het
Other mutations in Kcnj10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Kcnj10 APN 1 172369583 missense probably benign 0.11
IGL02743:Kcnj10 APN 1 172369654 missense possibly damaging 0.95
R0052:Kcnj10 UTSW 1 172368924 missense probably benign 0.30
R0490:Kcnj10 UTSW 1 172369452 missense probably damaging 0.96
R1424:Kcnj10 UTSW 1 172369255 missense probably damaging 1.00
R2153:Kcnj10 UTSW 1 172369888 missense possibly damaging 0.90
R3735:Kcnj10 UTSW 1 172369966 missense possibly damaging 0.81
R3826:Kcnj10 UTSW 1 172370049 missense probably damaging 1.00
R4725:Kcnj10 UTSW 1 172369159 missense probably damaging 1.00
R4726:Kcnj10 UTSW 1 172369072 missense probably damaging 1.00
R5434:Kcnj10 UTSW 1 172369480 missense probably damaging 1.00
R5755:Kcnj10 UTSW 1 172369594 missense possibly damaging 0.81
R6146:Kcnj10 UTSW 1 172369325 nonsense probably null
R7029:Kcnj10 UTSW 1 172368996 missense probably benign 0.07
R7235:Kcnj10 UTSW 1 172369426 missense probably damaging 0.98
R7350:Kcnj10 UTSW 1 172369260 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GGAAGAGTCTCCTCATTGGATG -3'
(R):5'- GCCACTTTCACAACCTGGTC -3'

Sequencing Primer
(F):5'- CTCATTGGATGCCAGGTGACAG -3'
(R):5'- TTTCACAACCTGGTCGAAAAGG -3'
Posted On2015-11-11