Incidental Mutation 'R4727:Plk4'
ID358520
Institutional Source Beutler Lab
Gene Symbol Plk4
Ensembl Gene ENSMUSG00000025758
Gene Namepolo like kinase 4
SynonymsStk18, Sak
MMRRC Submission 041602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4727 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location40800019-40816883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40805154 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 162 (N162D)
Ref Sequence ENSEMBL: ENSMUSP00000145277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204473]
Predicted Effect probably benign
Transcript: ENSMUST00000026858
AA Change: N162D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758
AA Change: N162D

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167556
AA Change: N162D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758
AA Change: N162D

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203295
AA Change: N162D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758
AA Change: N162D

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203320
Predicted Effect probably benign
Transcript: ENSMUST00000203895
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204289
Predicted Effect probably benign
Transcript: ENSMUST00000204473
SMART Domains Protein: ENSMUSP00000144693
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 13 114 4.9e-17 PFAM
Pfam:Pkinase 13 115 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205046
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,178,286 N483S probably benign Het
Acoxl T G 2: 127,978,738 L70R probably damaging Het
Ankrd44 A T 1: 54,667,417 F627I probably benign Het
Ash2l A T 8: 25,818,595 I552N probably damaging Het
B4galt1 A G 4: 40,807,812 S330P probably damaging Het
Bnip3 T C 7: 138,898,706 S52G probably damaging Het
Btd A G 14: 31,662,321 Q88R probably benign Het
C4bp A G 1: 130,639,185 V318A probably benign Het
Cacna1e G A 1: 154,436,468 Q1530* probably null Het
Calm1 T C 12: 100,200,226 F23S probably benign Het
Cep290 T G 10: 100,563,270 I2218R probably benign Het
Ces2c T C 8: 104,848,040 I43T probably benign Het
Cyp2d9 T C 15: 82,454,401 L1P probably null Het
Dgki C A 6: 37,299,813 probably benign Het
Dhh A G 15: 98,898,142 L44P probably damaging Het
Dnah12 A G 14: 26,872,317 I3409V probably damaging Het
Dnah7b G A 1: 46,207,656 R1664H probably damaging Het
Dnah8 T C 17: 30,851,747 M4469T probably damaging Het
Ehhadh T C 16: 21,762,431 I604V probably benign Het
Esr1 A G 10: 5,001,418 I599V probably benign Het
Faf1 G A 4: 109,840,367 D297N probably damaging Het
Gfra1 A T 19: 58,263,954 N380K probably damaging Het
Ghitm A G 14: 37,133,743 C8R probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Itsn2 A G 12: 4,707,660 Y1424C probably damaging Het
Kcnj10 A G 1: 172,369,699 D260G probably damaging Het
Klf16 T C 10: 80,569,186 D164G probably damaging Het
Klhdc7b T A 15: 89,387,582 L889Q probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Lrp11 A G 10: 7,590,584 E153G probably benign Het
Lrrc43 A T 5: 123,494,303 T170S probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Man1a A T 10: 53,907,572 probably null Het
Mmp24 C T 2: 155,815,899 P570S possibly damaging Het
Ms4a3 A G 19: 11,631,378 M170T probably damaging Het
Naip5 C A 13: 100,221,870 A953S possibly damaging Het
Nfrkb T C 9: 31,403,623 S580P probably damaging Het
Olfr638 T G 7: 104,003,890 V205G probably benign Het
Olfr885 T C 9: 38,062,093 Y258H probably damaging Het
Padi6 T G 4: 140,731,195 D462A probably damaging Het
Pde6a A G 18: 61,231,489 R206G probably benign Het
Ptpn13 T A 5: 103,569,855 D1922E probably benign Het
Rangap1 G A 15: 81,729,755 probably benign Het
Rapgef3 A G 15: 97,760,600 L175P probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Satb1 T C 17: 51,804,347 Y161C probably damaging Het
Sel1l3 C A 5: 53,144,183 probably null Het
Slc17a7 C T 7: 45,172,934 S398L possibly damaging Het
Slc22a4 T A 11: 54,027,651 E109V possibly damaging Het
Slc26a7 C T 4: 14,590,477 A105T probably damaging Het
Slc47a1 T C 11: 61,363,451 N145S possibly damaging Het
Tank A G 2: 61,653,532 T441A probably benign Het
Tefm T C 11: 80,140,453 probably benign Het
Ttbk2 T C 2: 120,745,370 Y1042C probably benign Het
Wdfy3 T C 5: 101,930,028 Q892R probably damaging Het
Wdr33 T A 18: 31,888,447 H683Q unknown Het
Zfp36l2 T A 17: 84,187,661 I12F probably benign Het
Zfyve26 A T 12: 79,244,396 M2145K probably benign Het
Other mutations in Plk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Plk4 APN 3 40801789 missense probably damaging 1.00
IGL01730:Plk4 APN 3 40805850 missense probably benign 0.00
IGL01906:Plk4 APN 3 40810381 missense probably null 0.01
IGL02021:Plk4 APN 3 40810708 missense probably damaging 0.97
IGL02718:Plk4 APN 3 40815021 missense probably damaging 1.00
IGL03287:Plk4 APN 3 40805118 missense probably benign 0.11
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0312:Plk4 UTSW 3 40813547 missense probably damaging 0.97
R0387:Plk4 UTSW 3 40812884 splice site probably benign
R0411:Plk4 UTSW 3 40811219 unclassified probably benign
R0480:Plk4 UTSW 3 40805640 missense probably benign 0.15
R1170:Plk4 UTSW 3 40801847 missense probably damaging 1.00
R1268:Plk4 UTSW 3 40811369 missense probably damaging 1.00
R1529:Plk4 UTSW 3 40806536 missense probably benign 0.09
R1987:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R1988:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R2050:Plk4 UTSW 3 40810380 missense probably benign
R4409:Plk4 UTSW 3 40806549 missense probably damaging 0.98
R4765:Plk4 UTSW 3 40802022 missense probably damaging 1.00
R4772:Plk4 UTSW 3 40805190 missense probably damaging 1.00
R5022:Plk4 UTSW 3 40802077 splice site probably null
R5363:Plk4 UTSW 3 40801984 missense possibly damaging 0.71
R5651:Plk4 UTSW 3 40813505 missense probably benign 0.00
R5665:Plk4 UTSW 3 40813586 missense possibly damaging 0.79
R5724:Plk4 UTSW 3 40801046 missense probably damaging 1.00
R6391:Plk4 UTSW 3 40808973 missense probably benign 0.05
R6694:Plk4 UTSW 3 40801828 missense probably damaging 1.00
R7412:Plk4 UTSW 3 40812178 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGATTTGAATTGTTAAGCTCTC -3'
(R):5'- GGCTGGCATTTCATAATCTGC -3'

Sequencing Primer
(F):5'- CTCTTTTTCTATCTTCACAGCTAGG -3'
(R):5'- GGCATTTCATAATCTGCCAGGAC -3'
Posted On2015-11-11