Mutagenetix > Incidental Mutations

Incidental Mutation 'R4727:Padi6'

358526

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

041602-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4727 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 140731195 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 462 (D462A)

Ref Sequence

ENSEMBL: ENSMUSP00000044044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]

AlphaFold

Q8K3V4

Predicted Effect

probably damaging
Transcript: ENSMUST00000038749
AA Change: D462A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: D462A

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125046

Predicted Effect

probably benign
Transcript: ENSMUST00000130267

SMART Domains

Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

Domain	Start	End	E-Value	Type
Pfam:PAD_M	39	191	1.1e-57	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	C	15: 91,178,286	N483S	probably benign	Het
Acoxl	T	G	2: 127,978,738	L70R	probably damaging	Het
Ankrd44	A	T	1: 54,667,417	F627I	probably benign	Het
Ash2l	A	T	8: 25,818,595	I552N	probably damaging	Het
B4galt1	A	G	4: 40,807,812	S330P	probably damaging	Het
Bnip3	T	C	7: 138,898,706	S52G	probably damaging	Het
Btd	A	G	14: 31,662,321	Q88R	probably benign	Het
C4bp	A	G	1: 130,639,185	V318A	probably benign	Het
Cacna1e	G	A	1: 154,436,468	Q1530*	probably null	Het
Calm1	T	C	12: 100,200,226	F23S	probably benign	Het
Cep290	T	G	10: 100,563,270	I2218R	probably benign	Het
Ces2c	T	C	8: 104,848,040	I43T	probably benign	Het
Cyp2d9	T	C	15: 82,454,401	L1P	probably null	Het
Dgki	C	A	6: 37,299,813		probably benign	Het
Dhh	A	G	15: 98,898,142	L44P	probably damaging	Het
Dnah12	A	G	14: 26,872,317	I3409V	probably damaging	Het
Dnah7b	G	A	1: 46,207,656	R1664H	probably damaging	Het
Dnah8	T	C	17: 30,851,747	M4469T	probably damaging	Het
Ehhadh	T	C	16: 21,762,431	I604V	probably benign	Het
Esr1	A	G	10: 5,001,418	I599V	probably benign	Het
Faf1	G	A	4: 109,840,367	D297N	probably damaging	Het
Gfra1	A	T	19: 58,263,954	N380K	probably damaging	Het
Ghitm	A	G	14: 37,133,743	C8R	probably damaging	Het
Ifna4	C	A	4: 88,842,282	T141K	probably benign	Het
Itsn2	A	G	12: 4,707,660	Y1424C	probably damaging	Het
Kcnj10	A	G	1: 172,369,699	D260G	probably damaging	Het
Klf16	T	C	10: 80,569,186	D164G	probably damaging	Het
Klhdc7b	T	A	15: 89,387,582	L889Q	probably damaging	Het
Lcmt2	C	G	2: 121,139,430	V171L	probably benign	Het
Lrp11	A	G	10: 7,590,584	E153G	probably benign	Het
Lrrc43	A	T	5: 123,494,303	T170S	probably damaging	Het
Lsr	T	C	7: 30,966,040	Y163C	probably damaging	Het
Man1a	A	T	10: 53,907,572		probably null	Het
Mmp24	C	T	2: 155,815,899	P570S	possibly damaging	Het
Ms4a3	A	G	19: 11,631,378	M170T	probably damaging	Het
Naip5	C	A	13: 100,221,870	A953S	possibly damaging	Het
Nfrkb	T	C	9: 31,403,623	S580P	probably damaging	Het
Olfr638	T	G	7: 104,003,890	V205G	probably benign	Het
Olfr885	T	C	9: 38,062,093	Y258H	probably damaging	Het
Pde6a	A	G	18: 61,231,489	R206G	probably benign	Het
Plk4	A	G	3: 40,805,154	N162D	probably benign	Het
Ptpn13	T	A	5: 103,569,855	D1922E	probably benign	Het
Rangap1	G	A	15: 81,729,755		probably benign	Het
Rapgef3	A	G	15: 97,760,600	L175P	probably damaging	Het
Rps6kb1	G	C	11: 86,544,658		probably null	Het
Satb1	T	C	17: 51,804,347	Y161C	probably damaging	Het
Sel1l3	C	A	5: 53,144,183		probably null	Het
Slc17a7	C	T	7: 45,172,934	S398L	possibly damaging	Het
Slc22a4	T	A	11: 54,027,651	E109V	possibly damaging	Het
Slc26a7	C	T	4: 14,590,477	A105T	probably damaging	Het
Slc47a1	T	C	11: 61,363,451	N145S	possibly damaging	Het
Tank	A	G	2: 61,653,532	T441A	probably benign	Het
Tefm	T	C	11: 80,140,453		probably benign	Het
Ttbk2	T	C	2: 120,745,370	Y1042C	probably benign	Het
Wdfy3	T	C	5: 101,930,028	Q892R	probably damaging	Het
Wdr33	T	A	18: 31,888,447	H683Q	unknown	Het
Zfp36l2	T	A	17: 84,187,661	I12F	probably benign	Het
Zfyve26	A	T	12: 79,244,396	M2145K	probably benign	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R1581:Padi6	UTSW	4	140735836	missense	probably damaging	1.00
R2024:Padi6	UTSW	4	140728968	missense	possibly damaging	0.78
R3150:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4168:Padi6	UTSW	4	140741934	missense	probably damaging	0.99
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7581:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R8333:Padi6	UTSW	4	140737376	missense	probably damaging	1.00
R8347:Padi6	UTSW	4	140735408	missense	probably benign	0.00
R8550:Padi6	UTSW	4	140732703	missense	probably benign	0.15
R8979:Padi6	UTSW	4	140739163	missense	probably benign	0.03
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACAGGGTCACGTTCCCATAG -3'
(R):5'- GCAGTCCAATGAAGTCCACC -3'

Sequencing Primer
(F):5'- GGGTCACGTTCCCATAGCCTTC -3'
(R):5'- CCAAAGAGGTGGCTCAGTTGTC -3'

Posted On

2015-11-11