Incidental Mutation 'R0321:Tprgl'
ID 35854
Institutional Source Beutler Lab
Gene Symbol Tprgl
Ensembl Gene ENSMUSG00000029030
Gene Name transformation related protein 63 regulated like
Synonyms 1200015A19Rik, mover
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R0321 (G1)
Quality Score 197
Status Validated
Chromosome 4
Chromosomal Location 154157485-154160666 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 154159355 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 115 (N115D)
Ref Sequence ENSEMBL: ENSMUSP00000101264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030895] [ENSMUST00000030896] [ENSMUST00000105639]
AlphaFold Q9DBS2
Predicted Effect probably benign
Transcript: ENSMUST00000030895
SMART Domains Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
Blast:WD40 38 77 4e-18 BLAST
Blast:WD40 81 120 6e-16 BLAST
Blast:WD40 125 163 9e-6 BLAST
WD40 167 208 2.28e2 SMART
WD40 215 251 1.58e-2 SMART
WD40 319 360 2.29e1 SMART
WD40 363 401 4.18e-2 SMART
Blast:WD40 402 443 2e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000030896
AA Change: N174D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030896
Gene: ENSMUSG00000029030
AA Change: N174D

DomainStartEndE-ValueType
Pfam:hSac2 56 163 3.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105639
AA Change: N115D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101264
Gene: ENSMUSG00000029030
AA Change: N115D

DomainStartEndE-ValueType
Pfam:hSac2 53 106 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142665
Predicted Effect probably benign
Transcript: ENSMUST00000146734
SMART Domains Protein: ENSMUSP00000118548
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
WD40 28 64 1.58e-2 SMART
Meta Mutation Damage Score 0.9450 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Tprgl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tprgl APN 4 154158433 missense probably damaging 1.00
R0025:Tprgl UTSW 4 154160345 splice site probably benign
R0037:Tprgl UTSW 4 154160137 missense possibly damaging 0.55
R1664:Tprgl UTSW 4 154159405 missense possibly damaging 0.74
R3737:Tprgl UTSW 4 154160128 missense probably benign 0.34
R6056:Tprgl UTSW 4 154160095 missense probably damaging 1.00
R6513:Tprgl UTSW 4 154159405 missense probably benign 0.14
R7289:Tprgl UTSW 4 154160574 missense possibly damaging 0.68
R8321:Tprgl UTSW 4 154160403 missense probably benign 0.04
R8362:Tprgl UTSW 4 154160358 missense possibly damaging 0.81
R8992:Tprgl UTSW 4 154158433 missense probably damaging 1.00
R9046:Tprgl UTSW 4 154158456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCAATGGGATGGTGACTCTG -3'
(R):5'- AGGCTGCAAAGGAGGCTCATTAAC -3'

Sequencing Primer
(F):5'- GGTGACTCTGTTCTTAAACAGCAC -3'
(R):5'- GAGGCTCATTAACTTGTTACGC -3'
Posted On 2013-05-09