Incidental Mutation 'R4727:Naip5'
ID358556
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission 041602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4727 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100221870 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 953 (A953S)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049789
AA Change: A953S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: A953S

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,178,286 N483S probably benign Het
Acoxl T G 2: 127,978,738 L70R probably damaging Het
Ankrd44 A T 1: 54,667,417 F627I probably benign Het
Ash2l A T 8: 25,818,595 I552N probably damaging Het
B4galt1 A G 4: 40,807,812 S330P probably damaging Het
Bnip3 T C 7: 138,898,706 S52G probably damaging Het
Btd A G 14: 31,662,321 Q88R probably benign Het
C4bp A G 1: 130,639,185 V318A probably benign Het
Cacna1e G A 1: 154,436,468 Q1530* probably null Het
Calm1 T C 12: 100,200,226 F23S probably benign Het
Cep290 T G 10: 100,563,270 I2218R probably benign Het
Ces2c T C 8: 104,848,040 I43T probably benign Het
Cyp2d9 T C 15: 82,454,401 L1P probably null Het
Dgki C A 6: 37,299,813 probably benign Het
Dhh A G 15: 98,898,142 L44P probably damaging Het
Dnah12 A G 14: 26,872,317 I3409V probably damaging Het
Dnah7b G A 1: 46,207,656 R1664H probably damaging Het
Dnah8 T C 17: 30,851,747 M4469T probably damaging Het
Ehhadh T C 16: 21,762,431 I604V probably benign Het
Esr1 A G 10: 5,001,418 I599V probably benign Het
Faf1 G A 4: 109,840,367 D297N probably damaging Het
Gfra1 A T 19: 58,263,954 N380K probably damaging Het
Ghitm A G 14: 37,133,743 C8R probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Itsn2 A G 12: 4,707,660 Y1424C probably damaging Het
Kcnj10 A G 1: 172,369,699 D260G probably damaging Het
Klf16 T C 10: 80,569,186 D164G probably damaging Het
Klhdc7b T A 15: 89,387,582 L889Q probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Lrp11 A G 10: 7,590,584 E153G probably benign Het
Lrrc43 A T 5: 123,494,303 T170S probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Man1a A T 10: 53,907,572 probably null Het
Mmp24 C T 2: 155,815,899 P570S possibly damaging Het
Ms4a3 A G 19: 11,631,378 M170T probably damaging Het
Nfrkb T C 9: 31,403,623 S580P probably damaging Het
Olfr638 T G 7: 104,003,890 V205G probably benign Het
Olfr885 T C 9: 38,062,093 Y258H probably damaging Het
Padi6 T G 4: 140,731,195 D462A probably damaging Het
Pde6a A G 18: 61,231,489 R206G probably benign Het
Plk4 A G 3: 40,805,154 N162D probably benign Het
Ptpn13 T A 5: 103,569,855 D1922E probably benign Het
Rangap1 G A 15: 81,729,755 probably benign Het
Rapgef3 A G 15: 97,760,600 L175P probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Satb1 T C 17: 51,804,347 Y161C probably damaging Het
Sel1l3 C A 5: 53,144,183 probably null Het
Slc17a7 C T 7: 45,172,934 S398L possibly damaging Het
Slc22a4 T A 11: 54,027,651 E109V possibly damaging Het
Slc26a7 C T 4: 14,590,477 A105T probably damaging Het
Slc47a1 T C 11: 61,363,451 N145S possibly damaging Het
Tank A G 2: 61,653,532 T441A probably benign Het
Tefm T C 11: 80,140,453 probably benign Het
Ttbk2 T C 2: 120,745,370 Y1042C probably benign Het
Wdfy3 T C 5: 101,930,028 Q892R probably damaging Het
Wdr33 T A 18: 31,888,447 H683Q unknown Het
Zfp36l2 T A 17: 84,187,661 I12F probably benign Het
Zfyve26 A T 12: 79,244,396 M2145K probably benign Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATCCGTGTTGTTCACTTG -3'
(R):5'- CAACACAGTTGCTGAATGCTCTC -3'

Sequencing Primer
(F):5'- ACTTGAACTTCCAGCTTGGGGATC -3'
(R):5'- TCCTTCGAGGAAAAACACTGG -3'
Posted On2015-11-11