Incidental Mutation 'R4727:Btd'
ID358558
Institutional Source Beutler Lab
Gene Symbol Btd
Ensembl Gene ENSMUSG00000021900
Gene Namebiotinidase
Synonyms
MMRRC Submission 041602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4727 (G1)
Quality Score178
Status Not validated
Chromosome14
Chromosomal Location31641028-31668579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31662321 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 88 (Q88R)
Ref Sequence ENSEMBL: ENSMUSP00000087608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090147]
Predicted Effect probably benign
Transcript: ENSMUST00000090147
AA Change: Q88R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087608
Gene: ENSMUSG00000021900
AA Change: Q88R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:CN_hydrolase 63 287 3.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128014
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit behavioral/neurological defects, weakness, bone loss, weight loss, and alopecia when fed a biotin-deprived diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,178,286 N483S probably benign Het
Acoxl T G 2: 127,978,738 L70R probably damaging Het
Ankrd44 A T 1: 54,667,417 F627I probably benign Het
Ash2l A T 8: 25,818,595 I552N probably damaging Het
B4galt1 A G 4: 40,807,812 S330P probably damaging Het
Bnip3 T C 7: 138,898,706 S52G probably damaging Het
C4bp A G 1: 130,639,185 V318A probably benign Het
Cacna1e G A 1: 154,436,468 Q1530* probably null Het
Calm1 T C 12: 100,200,226 F23S probably benign Het
Cep290 T G 10: 100,563,270 I2218R probably benign Het
Ces2c T C 8: 104,848,040 I43T probably benign Het
Cyp2d9 T C 15: 82,454,401 L1P probably null Het
Dgki C A 6: 37,299,813 probably benign Het
Dhh A G 15: 98,898,142 L44P probably damaging Het
Dnah12 A G 14: 26,872,317 I3409V probably damaging Het
Dnah7b G A 1: 46,207,656 R1664H probably damaging Het
Dnah8 T C 17: 30,851,747 M4469T probably damaging Het
Ehhadh T C 16: 21,762,431 I604V probably benign Het
Esr1 A G 10: 5,001,418 I599V probably benign Het
Faf1 G A 4: 109,840,367 D297N probably damaging Het
Gfra1 A T 19: 58,263,954 N380K probably damaging Het
Ghitm A G 14: 37,133,743 C8R probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Itsn2 A G 12: 4,707,660 Y1424C probably damaging Het
Kcnj10 A G 1: 172,369,699 D260G probably damaging Het
Klf16 T C 10: 80,569,186 D164G probably damaging Het
Klhdc7b T A 15: 89,387,582 L889Q probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Lrp11 A G 10: 7,590,584 E153G probably benign Het
Lrrc43 A T 5: 123,494,303 T170S probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Man1a A T 10: 53,907,572 probably null Het
Mmp24 C T 2: 155,815,899 P570S possibly damaging Het
Ms4a3 A G 19: 11,631,378 M170T probably damaging Het
Naip5 C A 13: 100,221,870 A953S possibly damaging Het
Nfrkb T C 9: 31,403,623 S580P probably damaging Het
Olfr638 T G 7: 104,003,890 V205G probably benign Het
Olfr885 T C 9: 38,062,093 Y258H probably damaging Het
Padi6 T G 4: 140,731,195 D462A probably damaging Het
Pde6a A G 18: 61,231,489 R206G probably benign Het
Plk4 A G 3: 40,805,154 N162D probably benign Het
Ptpn13 T A 5: 103,569,855 D1922E probably benign Het
Rangap1 G A 15: 81,729,755 probably benign Het
Rapgef3 A G 15: 97,760,600 L175P probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Satb1 T C 17: 51,804,347 Y161C probably damaging Het
Sel1l3 C A 5: 53,144,183 probably null Het
Slc17a7 C T 7: 45,172,934 S398L possibly damaging Het
Slc22a4 T A 11: 54,027,651 E109V possibly damaging Het
Slc26a7 C T 4: 14,590,477 A105T probably damaging Het
Slc47a1 T C 11: 61,363,451 N145S possibly damaging Het
Tank A G 2: 61,653,532 T441A probably benign Het
Tefm T C 11: 80,140,453 probably benign Het
Ttbk2 T C 2: 120,745,370 Y1042C probably benign Het
Wdfy3 T C 5: 101,930,028 Q892R probably damaging Het
Wdr33 T A 18: 31,888,447 H683Q unknown Het
Zfp36l2 T A 17: 84,187,661 I12F probably benign Het
Zfyve26 A T 12: 79,244,396 M2145K probably benign Het
Other mutations in Btd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Btd APN 14 31667776 missense probably benign 0.00
IGL02728:Btd APN 14 31667362 missense probably benign 0.00
IGL02965:Btd APN 14 31667236 missense probably damaging 1.00
R1503:Btd UTSW 14 31667655 missense probably damaging 1.00
R1662:Btd UTSW 14 31666790 missense probably damaging 1.00
R1817:Btd UTSW 14 31662289 missense possibly damaging 0.95
R1868:Btd UTSW 14 31667309 missense probably benign 0.13
R2225:Btd UTSW 14 31667060 missense probably benign 0.00
R2418:Btd UTSW 14 31641136 critical splice donor site probably null
R4660:Btd UTSW 14 31667803 missense probably benign 0.00
R4923:Btd UTSW 14 31662087 missense possibly damaging 0.92
R5703:Btd UTSW 14 31667047 nonsense probably null
R5806:Btd UTSW 14 31667512 missense probably benign
R6110:Btd UTSW 14 31641108 unclassified probably benign
R6119:Btd UTSW 14 31641108 unclassified probably benign
R6120:Btd UTSW 14 31641108 unclassified probably benign
R7019:Btd UTSW 14 31667105 missense probably damaging 1.00
R7019:Btd UTSW 14 31667106 missense possibly damaging 0.88
R7021:Btd UTSW 14 31667831 missense probably benign
R7837:Btd UTSW 14 31666827 missense possibly damaging 0.90
R7920:Btd UTSW 14 31666827 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCATTATGTCTGGAGCCC -3'
(R):5'- TTGGGCAAAACACTCCCTGG -3'

Sequencing Primer
(F):5'- ATTATGTCTGGAGCCCGCACTG -3'
(R):5'- ACACTCCCTGGGGACACATG -3'
Posted On2015-11-11