Incidental Mutation 'R0321:Dnah10'
ID35856
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Namedynein, axonemal, heavy chain 10
SynonymsDnahc10
MMRRC Submission 038531-MU
Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0321 (G1)
Quality Score214
Status Validated
Chromosome5
Chromosomal Location124725085-124834308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124823352 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 3834 (D3834G)
Ref Sequence ENSEMBL: ENSMUSP00000114593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: D3891G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: D3891G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: D3834G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: D3834G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196708
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124828603 missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124746616 missense probably benign 0.01
IGL00471:Dnah10 APN 5 124794341 missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124775512 missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124777212 missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124779154 missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124783946 missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124821341 missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124732489 missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124803328 missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124787465 missense probably benign 0.10
IGL01757:Dnah10 APN 5 124768927 missense probably benign 0.37
IGL01759:Dnah10 APN 5 124755786 missense probably benign
IGL01767:Dnah10 APN 5 124743737 splice site probably benign
IGL01769:Dnah10 APN 5 124764944 missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124783921 missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124789812 missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124804746 missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124819366 missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124833423 critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124773067 missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124773819 missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124789796 missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124793852 missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124821287 missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124787331 missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124799005 missense probably benign 0.26
IGL02709:Dnah10 APN 5 124773745 nonsense probably null
IGL02740:Dnah10 APN 5 124826863 splice site probably benign
IGL02746:Dnah10 APN 5 124730086 missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124798014 missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124801822 missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124763133 missense probably benign 0.07
IGL03076:Dnah10 APN 5 124730162 critical splice donor site probably null
IGL03109:Dnah10 APN 5 124764886 missense probably benign 0.10
IGL03181:Dnah10 APN 5 124748457 missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124817643 missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124817697 missense probably benign 0.00
IGL03328:Dnah10 APN 5 124754290 missense probably benign 0.06
frosty UTSW 5 124828137 missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124829529 missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124730100 missense probably benign
P0019:Dnah10 UTSW 5 124763066 missense probably benign
P0037:Dnah10 UTSW 5 124817992 nonsense probably null
PIT4366001:Dnah10 UTSW 5 124775524 missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124726902 missense probably benign
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124830744 missense probably benign 0.00
R0066:Dnah10 UTSW 5 124763076 missense probably benign 0.01
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124834075 missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124796369 splice site probably benign
R0410:Dnah10 UTSW 5 124755735 missense probably benign
R0480:Dnah10 UTSW 5 124808851 missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124812723 critical splice donor site probably null
R0533:Dnah10 UTSW 5 124775250 splice site probably null
R0599:Dnah10 UTSW 5 124800953 missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124750812 missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124829577 missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124797938 missense probably benign 0.00
R1203:Dnah10 UTSW 5 124760014 splice site probably null
R1248:Dnah10 UTSW 5 124755823 splice site probably benign
R1366:Dnah10 UTSW 5 124753326 missense probably benign 0.41
R1434:Dnah10 UTSW 5 124774986 missense probably benign 0.03
R1436:Dnah10 UTSW 5 124762221 missense probably benign 0.00
R1438:Dnah10 UTSW 5 124798945 missense probably benign 0.25
R1446:Dnah10 UTSW 5 124789796 missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124743686 missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1479:Dnah10 UTSW 5 124777889 missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124754239 missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124760952 missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124829614 missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124765562 missense probably benign 0.00
R1709:Dnah10 UTSW 5 124760091 missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124773190 intron probably null
R1828:Dnah10 UTSW 5 124761279 missense probably benign 0.00
R1854:Dnah10 UTSW 5 124804689 missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124832526 unclassified probably null
R1893:Dnah10 UTSW 5 124754317 missense probably benign 0.13
R1895:Dnah10 UTSW 5 124758430 missense probably benign 0.00
R1906:Dnah10 UTSW 5 124800984 missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124782268 missense probably benign 0.00
R1965:Dnah10 UTSW 5 124775203 missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124833988 missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124829587 missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124746704 missense probably benign 0.30
R2046:Dnah10 UTSW 5 124796341 missense probably benign 0.25
R2074:Dnah10 UTSW 5 124814674 missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124774981 missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124761237 missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124731466 missense probably benign 0.00
R2293:Dnah10 UTSW 5 124819221 missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124742000 missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124762865 critical splice donor site probably null
R2571:Dnah10 UTSW 5 124775478 missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124817670 missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124819412 critical splice donor site probably null
R3439:Dnah10 UTSW 5 124796258 missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124747630 missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124773031 missense probably benign 0.37
R4015:Dnah10 UTSW 5 124777926 missense probably benign 0.25
R4261:Dnah10 UTSW 5 124730137 missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124732330 missense probably benign 0.28
R4299:Dnah10 UTSW 5 124819925 missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124762869 splice site probably null
R4651:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4652:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4664:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124775517 missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124747745 missense probably benign 0.01
R4806:Dnah10 UTSW 5 124819344 missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124773132 missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124817748 missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124762196 missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124832513 missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5119:Dnah10 UTSW 5 124779258 missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124798960 missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124787420 missense probably benign 0.00
R5262:Dnah10 UTSW 5 124785156 missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124828137 missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124791787 missense probably benign 0.01
R5322:Dnah10 UTSW 5 124773566 missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124743629 missense probably benign 0.16
R5468:Dnah10 UTSW 5 124830493 missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124753168 missense probably benign
R5587:Dnah10 UTSW 5 124793913 missense probably benign 0.10
R5724:Dnah10 UTSW 5 124742026 missense probably benign 0.27
R5797:Dnah10 UTSW 5 124821386 missense probably benign 0.00
R5812:Dnah10 UTSW 5 124747746 missense probably benign 0.01
R5846:Dnah10 UTSW 5 124823373 missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R5961:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5970:Dnah10 UTSW 5 124808729 missense probably benign
R6021:Dnah10 UTSW 5 124736984 missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124801860 missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124819210 missense probably benign 0.09
R6080:Dnah10 UTSW 5 124805897 missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124753174 missense probably benign 0.18
R6155:Dnah10 UTSW 5 124770599 missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124785175 missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124823318 missense probably benign 0.02
R6238:Dnah10 UTSW 5 124743679 missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124794219 splice site probably null
R6275:Dnah10 UTSW 5 124785184 missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124775080 missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124829646 missense probably benign 0.00
R6458:Dnah10 UTSW 5 124809269 missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124762782 missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124758355 missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124830033 missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124760159 missense probably benign 0.45
R6702:Dnah10 UTSW 5 124805805 missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124808812 missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124777826 missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124790000 intron probably null
R6932:Dnah10 UTSW 5 124821450 missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124787426 missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124816142 missense probably benign 0.37
R7138:Dnah10 UTSW 5 124822945 missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124822942 missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124813828 missense probably benign 0.19
R7278:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R7284:Dnah10 UTSW 5 124832598 missense probably benign 0.37
R7322:Dnah10 UTSW 5 124821269 missense probably benign 0.08
R7523:Dnah10 UTSW 5 124747739 missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124799031 missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124763066 missense probably benign
U24488:Dnah10 UTSW 5 124813980 missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124765697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGCCCACCTCAGAAACCTTTGC -3'
(R):5'- CACACAGTTACCGGGGATTGGATG -3'

Sequencing Primer
(F):5'- TAAGCTGTCAAGCTGGGCTTAC -3'
(R):5'- GGAAGCATTTTCCTGGCAAG -3'
Posted On2013-05-09