Mutagenetix > Incidental Mutations

Incidental Mutation 'R4728:Serpinb13'

358575

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

042020-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R4728 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106982844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 66 (S66L)

Ref Sequence

ENSEMBL: ENSMUSP00000118572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027564
AA Change: S66L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136766
AA Change: S66L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

94% (73/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bicc1	C	T	10: 70,935,831		probably null	Het
Bpifc	T	A	10: 85,991,199	H162L	possibly damaging	Het
Ccdc163	C	T	4: 116,709,012		probably benign	Het
Cldn12	A	G	5: 5,508,385	F14S	probably damaging	Het
Cyth4	G	A	15: 78,602,713	G14R	probably benign	Het
Ddhd2	C	T	8: 25,752,267	V194I	probably damaging	Het
Ddx23	A	T	15: 98,650,225	V433E	probably damaging	Het
Defb34	A	G	8: 19,126,418	N42D	possibly damaging	Het
Dennd6a	A	G	14: 26,627,420	E313G	probably null	Het
Dhx30	A	G	9: 110,087,650	F570S	probably damaging	Het
Dnah3	T	C	7: 120,059,366	E864G	probably damaging	Het
Eps8	G	A	6: 137,509,162	Q451*	probably null	Het
Fmo9	A	T	1: 166,663,311	Y533N	possibly damaging	Het
Fut8	T	A	12: 77,475,199	D537E	probably damaging	Het
Gm5407	T	C	16: 49,296,920		noncoding transcript	Het
Gm9916	A	G	3: 118,435,041		noncoding transcript	Het
Grm5	T	A	7: 87,975,288	F354L	probably damaging	Het
Hira	C	T	16: 18,922,904	A353V	probably damaging	Het
Ifna4	C	A	4: 88,842,282	T141K	probably benign	Het
Igf1r	T	C	7: 68,189,624	L628P	probably damaging	Het
Kcnh5	A	T	12: 75,007,781	I463N	probably damaging	Het
Kcnh8	C	A	17: 52,725,870	Q62K	probably damaging	Het
Kif3c	A	T	12: 3,365,873		probably benign	Het
Kmo	A	G	1: 175,656,763	D353G	possibly damaging	Het
Lrp1	T	C	10: 127,563,737	T2301A	probably damaging	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Map3k9	C	T	12: 81,722,373	R967Q	probably damaging	Het
Mcm8	A	G	2: 132,832,854	H414R	probably damaging	Het
Mier1	A	G	4: 103,140,205	E145G	probably damaging	Het
Mlc1	A	T	15: 88,978,031		probably null	Het
Napb	T	C	2: 148,709,325	D96G	probably damaging	Het
Nbas	T	A	12: 13,288,739	S193R	probably damaging	Het
Nlrp4a	T	C	7: 26,475,090	V967A	probably benign	Het
Nlrp4e	T	A	7: 23,321,564	I492K	probably benign	Het
Notch4	A	G	17: 34,570,205	T497A	probably benign	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Ogdh	T	A	11: 6,342,549	Y417N	probably damaging	Het
Olfr1152	T	C	2: 87,868,435	V148A	probably benign	Het
Ovol1	A	T	19: 5,553,662	Y70*	probably null	Het
P2ry1	A	G	3: 61,004,220	Y260C	probably damaging	Het
Pcx	G	T	19: 4,603,096	R263L	probably damaging	Het
Pla2g4f	T	A	2: 120,300,921	T774S	probably benign	Het
Prdm15	T	G	16: 97,821,786	K289Q	probably benign	Het
Prl7c1	A	T	13: 27,776,285	H91Q	probably benign	Het
Prmt5	C	T	14: 54,507,907	R601H	probably benign	Het
Prrc2b	T	A	2: 32,230,625	D2192E	probably damaging	Het
Ptdss2	A	G	7: 141,154,459	I299V	probably benign	Het
Rbm28	A	G	6: 29,143,592	V354A	probably damaging	Het
Rps6kb1	G	C	11: 86,544,658		probably null	Het
Sema3f	A	G	9: 107,705,440	S35P	probably benign	Het
Serpina3n	A	T	12: 104,409,163	T165S	probably benign	Het
Sh2d4b	T	A	14: 40,842,432	R267*	probably null	Het
Slc5a12	A	T	2: 110,644,424	K554*	probably null	Het
Snrnp200	T	C	2: 127,217,414	L409P	probably damaging	Het
Snrnp200	T	A	2: 127,227,878	V981E	possibly damaging	Het
Spon2	T	A	5: 33,217,338	R41S	probably benign	Het
Sptb	A	T	12: 76,583,379	M2279K	probably benign	Het
Srcap	T	G	7: 127,540,924		probably null	Het
Tctn3	A	G	19: 40,605,742	V409A	probably damaging	Het
Tg	A	C	15: 66,682,827	Q697P	probably damaging	Het
Tmem181a	A	G	17: 6,290,599	D141G	probably benign	Het
Tmem82	A	G	4: 141,614,652	S334P	probably benign	Het
Ubr4	A	G	4: 139,423,879	Y1875C	probably damaging	Het
Vmn1r63	C	A	7: 5,803,363	R90L	probably damaging	Het
Zfp330	A	C	8: 82,770,846	Y56D	probably damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGCAACATAGACATTTCTCTGG -3'
(R):5'- TCCAGGAGCTTTTGAGCAAG -3'

Sequencing Primer
(F):5'- AGACATTTCTCTGGCTTTTCAAGGAG -3'
(R):5'- AGCCTCTAGGACTTTGTTATAGCAGC -3'

Posted On

2015-11-11