Incidental Mutation 'R4728:Kmo'
ID358577
Institutional Source Beutler Lab
Gene Symbol Kmo
Ensembl Gene ENSMUSG00000039783
Gene Namekynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Synonyms
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4728 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175620381-175662116 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175656763 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 353 (D353G)
Ref Sequence ENSEMBL: ENSMUSP00000095067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040250
AA Change: D353G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783
AA Change: D353G

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097458
AA Change: D353G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783
AA Change: D353G

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140474
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142223
Meta Mutation Damage Score 0.1625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrion outer membrane protein that catalyzes the hydroxylation of L-tryptophan metabolite, L-kynurenine, to form L-3-hydroxykynurenine. Studies in yeast identified this gene as a therapeutic target for Huntington disease. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack kynurenine 3-monooxygenase activity and altered levels of several tryptophan metabolites. Mice homozygous for another null allele exhibit increased LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,935,831 probably null Het
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh5 A T 12: 75,007,781 I463N probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Napb T C 2: 148,709,325 D96G probably damaging Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Olfr1152 T C 2: 87,868,435 V148A probably benign Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pcx G T 19: 4,603,096 R263L probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Sema3f A G 9: 107,705,440 S35P probably benign Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Snrnp200 T C 2: 127,217,414 L409P probably damaging Het
Snrnp200 T A 2: 127,227,878 V981E possibly damaging Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Kmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Kmo APN 1 175655095 missense possibly damaging 0.54
IGL01734:Kmo APN 1 175655102 missense probably benign 0.00
IGL02415:Kmo APN 1 175649323 splice site probably benign
IGL02551:Kmo APN 1 175637919 missense probably damaging 1.00
IGL02866:Kmo APN 1 175653588 missense probably damaging 1.00
IGL03140:Kmo APN 1 175649220 missense probably damaging 1.00
R0613:Kmo UTSW 1 175637892 missense probably damaging 1.00
R0617:Kmo UTSW 1 175647190 missense possibly damaging 0.85
R0883:Kmo UTSW 1 175647140 missense possibly damaging 0.70
R1034:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1037:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1164:Kmo UTSW 1 175658559 missense probably benign 0.00
R1519:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1519:Kmo UTSW 1 175656802 missense probably damaging 1.00
R1712:Kmo UTSW 1 175656723 missense probably benign
R1796:Kmo UTSW 1 175637895 missense probably benign 0.00
R1938:Kmo UTSW 1 175651588 missense possibly damaging 0.88
R4531:Kmo UTSW 1 175659707 unclassified probably null
R4586:Kmo UTSW 1 175650572 missense probably damaging 1.00
R4586:Kmo UTSW 1 175650573 missense possibly damaging 0.90
R4603:Kmo UTSW 1 175651642 missense probably benign 0.13
R4647:Kmo UTSW 1 175659774 nonsense probably null
R5569:Kmo UTSW 1 175655122 missense probably benign 0.04
R5571:Kmo UTSW 1 175647194 missense possibly damaging 0.46
R6109:Kmo UTSW 1 175637908 missense possibly damaging 0.67
R6244:Kmo UTSW 1 175659695 missense possibly damaging 0.91
R6943:Kmo UTSW 1 175658375 missense probably benign 0.00
R7148:Kmo UTSW 1 175651602 missense probably damaging 1.00
R7319:Kmo UTSW 1 175653655 missense probably damaging 0.97
R7450:Kmo UTSW 1 175639100 missense probably benign 0.01
R7545:Kmo UTSW 1 175653628 missense probably damaging 1.00
X0027:Kmo UTSW 1 175647193 missense probably benign 0.00
Z1177:Kmo UTSW 1 175649186 missense not run
Predicted Primers PCR Primer
(F):5'- CTTTGACCTAGCTGGAGACC -3'
(R):5'- TGGCTACATAGTAACACTCTAGC -3'

Sequencing Primer
(F):5'- CATAGATACCCTTGGAGGCCAG -3'
(R):5'- CACATGTGCATGCTCATGAG -3'
Posted On2015-11-11