Incidental Mutation 'R4728:Olfr1152'
ID358580
Institutional Source Beutler Lab
Gene Symbol Olfr1152
Ensembl Gene ENSMUSG00000045225
Gene Nameolfactory receptor 1152
SynonymsMOR177-12, GA_x6K02T2Q125-49372426-49373358
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4728 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87866492-87874156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87868435 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000151045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051058] [ENSMUST00000213308]
Predicted Effect probably benign
Transcript: ENSMUST00000051058
AA Change: V148A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054645
Gene: ENSMUSG00000045225
AA Change: V148A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-46 PFAM
Pfam:7tm_1 40 290 1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121994
Predicted Effect probably benign
Transcript: ENSMUST00000213308
AA Change: V148A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,935,831 probably null Het
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh5 A T 12: 75,007,781 I463N probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Kmo A G 1: 175,656,763 D353G possibly damaging Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Napb T C 2: 148,709,325 D96G probably damaging Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pcx G T 19: 4,603,096 R263L probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Sema3f A G 9: 107,705,440 S35P probably benign Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Snrnp200 T C 2: 127,217,414 L409P probably damaging Het
Snrnp200 T A 2: 127,227,878 V981E possibly damaging Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Olfr1152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Olfr1152 APN 2 87868465 missense probably benign 0.00
IGL01618:Olfr1152 APN 2 87868144 missense probably damaging 0.96
IGL02326:Olfr1152 APN 2 87868675 missense probably damaging 1.00
IGL03162:Olfr1152 APN 2 87868140 missense probably benign 0.00
IGL03189:Olfr1152 APN 2 87868215 missense possibly damaging 0.76
I2288:Olfr1152 UTSW 2 87868135 missense probably damaging 1.00
R0761:Olfr1152 UTSW 2 87868536 missense possibly damaging 0.88
R1558:Olfr1152 UTSW 2 87868115 missense probably damaging 1.00
R1938:Olfr1152 UTSW 2 87868461 missense probably benign 0.01
R3810:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R3812:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R4928:Olfr1152 UTSW 2 87868230 missense probably benign 0.32
R5172:Olfr1152 UTSW 2 87868827 missense probably benign 0.20
R5174:Olfr1152 UTSW 2 87868411 missense possibly damaging 0.79
R6147:Olfr1152 UTSW 2 87868717 missense probably benign 0.03
R6195:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6233:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6541:Olfr1152 UTSW 2 87868294 missense probably benign 0.11
R7507:Olfr1152 UTSW 2 87868369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTTATTGGACCTGCTTGC -3'
(R):5'- TGAGATGGTGCTCAGTTCAATG -3'

Sequencing Primer
(F):5'- ATTGGACCTGCTTGCCAAGAG -3'
(R):5'- GGTGCTCAGTTCAATGAAACC -3'
Posted On2015-11-11