Incidental Mutation 'R4728:Napb'
ID358585
Institutional Source Beutler Lab
Gene Symbol Napb
Ensembl Gene ENSMUSG00000027438
Gene NameN-ethylmaleimide sensitive fusion protein attachment protein beta
SynonymsSNARE, Brp14, b-SNAP, E161, I47
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4728 (G1)
Quality Score200
Status Validated
Chromosome2
Chromosomal Location148693985-148732467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148709325 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 96 (D96G)
Ref Sequence ENSEMBL: ENSMUSP00000120979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028926] [ENSMUST00000136513]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028926
AA Change: D96G

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028926
Gene: ENSMUSG00000027438
AA Change: D96G

DomainStartEndE-ValueType
Pfam:SNAP 8 288 7.3e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136513
AA Change: D96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120979
Gene: ENSMUSG00000027438
AA Change: D96G

DomainStartEndE-ValueType
Pfam:SNAP 8 114 3.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140647
Meta Mutation Damage Score 0.3259 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit seizures, ataxia, abnormal synaptic vesicle priming, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,935,831 probably null Het
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh5 A T 12: 75,007,781 I463N probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Kmo A G 1: 175,656,763 D353G possibly damaging Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Olfr1152 T C 2: 87,868,435 V148A probably benign Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pcx G T 19: 4,603,096 R263L probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Sema3f A G 9: 107,705,440 S35P probably benign Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Snrnp200 T C 2: 127,217,414 L409P probably damaging Het
Snrnp200 T A 2: 127,227,878 V981E possibly damaging Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Napb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Napb APN 2 148707169 missense probably damaging 0.97
IGL02987:Napb APN 2 148697511 splice site probably null
R0068:Napb UTSW 2 148698923 splice site probably benign
R0068:Napb UTSW 2 148698923 splice site probably benign
R1218:Napb UTSW 2 148700425 missense probably damaging 1.00
R1851:Napb UTSW 2 148706989 missense probably benign 0.01
R3508:Napb UTSW 2 148698960 missense probably benign
R3689:Napb UTSW 2 148703057 splice site probably null
R3691:Napb UTSW 2 148703057 splice site probably null
R4377:Napb UTSW 2 148732264 critical splice donor site probably null
R4541:Napb UTSW 2 148709309 splice site probably benign
R5028:Napb UTSW 2 148703137 missense possibly damaging 0.90
R5982:Napb UTSW 2 148700491 splice site probably null
R6228:Napb UTSW 2 148698178 splice site probably null
R6944:Napb UTSW 2 148706969 missense probably benign
R6998:Napb UTSW 2 148700425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCTTAACCCTTTCAGACTAATG -3'
(R):5'- TGTTTCAATGTGACGCCTCTG -3'

Sequencing Primer
(F):5'- TATTACCGGGACTTAGCG -3'
(R):5'- GCAAAGCCTCCTTTTAGAGACTTGG -3'
Posted On2015-11-11