Incidental Mutation 'R4728:Mier1'
ID 358591
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms 4933425I22Rik, 5830411K19Rik
MMRRC Submission 042020-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4728 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 102971587-103022951 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102997402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 145 (E145G)
Ref Sequence ENSEMBL: ENSMUSP00000102470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106855] [ENSMUST00000106857] [ENSMUST00000106858]
AlphaFold Q5UAK0
Predicted Effect possibly damaging
Transcript: ENSMUST00000030247
AA Change: E162G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: E162G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097945
AA Change: E190G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: E190G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106855
SMART Domains Protein: ENSMUSP00000102468
Gene: ENSMUSG00000028522

DomainStartEndE-ValueType
ELM2 1 53 2.51e-8 SMART
SANT 102 151 7.01e-9 SMART
low complexity region 184 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106857
AA Change: E145G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: E145G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106858
AA Change: E162G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: E162G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149259
Meta Mutation Damage Score 0.1525 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,771,661 (GRCm39) probably null Het
Bpifc T A 10: 85,827,063 (GRCm39) H162L possibly damaging Het
Ccdc163 C T 4: 116,566,209 (GRCm39) probably benign Het
Cldn12 A G 5: 5,558,385 (GRCm39) F14S probably damaging Het
Cyth4 G A 15: 78,486,913 (GRCm39) G14R probably benign Het
Ddhd2 C T 8: 26,242,294 (GRCm39) V194I probably damaging Het
Ddx23 A T 15: 98,548,106 (GRCm39) V433E probably damaging Het
Defb34 A G 8: 19,176,434 (GRCm39) N42D possibly damaging Het
Dennd6a A G 14: 26,348,575 (GRCm39) E313G probably null Het
Dhx30 A G 9: 109,916,718 (GRCm39) F570S probably damaging Het
Dnah3 T C 7: 119,658,589 (GRCm39) E864G probably damaging Het
Eps8 G A 6: 137,486,160 (GRCm39) Q451* probably null Het
Fmo9 A T 1: 166,490,880 (GRCm39) Y533N possibly damaging Het
Fut8 T A 12: 77,521,973 (GRCm39) D537E probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gm9916 A G 3: 118,228,690 (GRCm39) noncoding transcript Het
Grm5 T A 7: 87,624,496 (GRCm39) F354L probably damaging Het
Hira C T 16: 18,741,654 (GRCm39) A353V probably damaging Het
Ifna4 C A 4: 88,760,519 (GRCm39) T141K probably benign Het
Igf1r T C 7: 67,839,372 (GRCm39) L628P probably damaging Het
Kcnh5 A T 12: 75,054,555 (GRCm39) I463N probably damaging Het
Kcnh8 C A 17: 53,032,898 (GRCm39) Q62K probably damaging Het
Kif3c A T 12: 3,415,873 (GRCm39) probably benign Het
Kmo A G 1: 175,484,329 (GRCm39) D353G possibly damaging Het
Lrp1 T C 10: 127,399,606 (GRCm39) T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Map3k9 C T 12: 81,769,147 (GRCm39) R967Q probably damaging Het
Mcm8 A G 2: 132,674,774 (GRCm39) H414R probably damaging Het
Mlc1 A T 15: 88,862,234 (GRCm39) probably null Het
Napb T C 2: 148,551,245 (GRCm39) D96G probably damaging Het
Nbas T A 12: 13,338,740 (GRCm39) S193R probably damaging Het
Nlrp4a T C 7: 26,174,515 (GRCm39) V967A probably benign Het
Nlrp4e T A 7: 23,020,989 (GRCm39) I492K probably benign Het
Notch4 A G 17: 34,789,179 (GRCm39) T497A probably benign Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Ogdh T A 11: 6,292,549 (GRCm39) Y417N probably damaging Het
Or5w19 T C 2: 87,698,779 (GRCm39) V148A probably benign Het
Ovol1 A T 19: 5,603,690 (GRCm39) Y70* probably null Het
P2ry1 A G 3: 60,911,641 (GRCm39) Y260C probably damaging Het
Pcx G T 19: 4,653,124 (GRCm39) R263L probably damaging Het
Pla2g4f T A 2: 120,131,402 (GRCm39) T774S probably benign Het
Prdm15 T G 16: 97,622,986 (GRCm39) K289Q probably benign Het
Prl7c1 A T 13: 27,960,268 (GRCm39) H91Q probably benign Het
Prmt5 C T 14: 54,745,364 (GRCm39) R601H probably benign Het
Prrc2b T A 2: 32,120,637 (GRCm39) D2192E probably damaging Het
Ptdss2 A G 7: 140,734,372 (GRCm39) I299V probably benign Het
Rbm28 A G 6: 29,143,591 (GRCm39) V354A probably damaging Het
Rps6kb1 G C 11: 86,435,484 (GRCm39) probably null Het
Sema3f A G 9: 107,582,639 (GRCm39) S35P probably benign Het
Serpina3n A T 12: 104,375,422 (GRCm39) T165S probably benign Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Sh2d4b T A 14: 40,564,389 (GRCm39) R267* probably null Het
Slc5a12 A T 2: 110,474,769 (GRCm39) K554* probably null Het
Snrnp200 T C 2: 127,059,334 (GRCm39) L409P probably damaging Het
Snrnp200 T A 2: 127,069,798 (GRCm39) V981E possibly damaging Het
Spon2 T A 5: 33,374,682 (GRCm39) R41S probably benign Het
Sptb A T 12: 76,630,153 (GRCm39) M2279K probably benign Het
Srcap T G 7: 127,140,096 (GRCm39) probably null Het
Tctn3 A G 19: 40,594,186 (GRCm39) V409A probably damaging Het
Tg A C 15: 66,554,676 (GRCm39) Q697P probably damaging Het
Tmem181a A G 17: 6,340,874 (GRCm39) D141G probably benign Het
Tmem82 A G 4: 141,341,963 (GRCm39) S334P probably benign Het
Ubr4 A G 4: 139,151,190 (GRCm39) Y1875C probably damaging Het
Vmn1r63 C A 7: 5,806,362 (GRCm39) R90L probably damaging Het
Zfp330 A C 8: 83,497,475 (GRCm39) Y56D probably damaging Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103,012,769 (GRCm39) missense probably damaging 0.99
IGL01599:Mier1 APN 4 103,012,738 (GRCm39) missense possibly damaging 0.58
IGL01996:Mier1 APN 4 102,984,473 (GRCm39) missense possibly damaging 0.93
IGL02228:Mier1 APN 4 102,988,259 (GRCm39) missense possibly damaging 0.85
R0194:Mier1 UTSW 4 102,996,716 (GRCm39) splice site probably null
R0505:Mier1 UTSW 4 103,012,820 (GRCm39) splice site probably benign
R0684:Mier1 UTSW 4 102,996,631 (GRCm39) missense probably damaging 0.99
R0691:Mier1 UTSW 4 102,996,699 (GRCm39) missense probably benign 0.07
R2997:Mier1 UTSW 4 102,988,233 (GRCm39) missense probably damaging 1.00
R4273:Mier1 UTSW 4 103,019,628 (GRCm39) missense possibly damaging 0.93
R4769:Mier1 UTSW 4 102,997,417 (GRCm39) missense probably benign 0.01
R4798:Mier1 UTSW 4 102,988,195 (GRCm39) missense probably damaging 1.00
R5075:Mier1 UTSW 4 102,996,670 (GRCm39) missense probably benign 0.02
R5260:Mier1 UTSW 4 103,019,907 (GRCm39) missense probably benign 0.04
R5663:Mier1 UTSW 4 103,007,739 (GRCm39) missense probably damaging 0.96
R5924:Mier1 UTSW 4 103,016,899 (GRCm39) nonsense probably null
R7253:Mier1 UTSW 4 102,996,544 (GRCm39) splice site probably null
R7304:Mier1 UTSW 4 102,996,599 (GRCm39) nonsense probably null
R7641:Mier1 UTSW 4 102,996,637 (GRCm39) missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103,019,812 (GRCm39) missense probably benign 0.09
R8000:Mier1 UTSW 4 102,988,240 (GRCm39) missense probably damaging 1.00
R8557:Mier1 UTSW 4 102,996,543 (GRCm39) splice site probably null
R9353:Mier1 UTSW 4 103,012,800 (GRCm39) missense probably damaging 0.97
R9537:Mier1 UTSW 4 103,019,758 (GRCm39) missense probably benign 0.00
R9759:Mier1 UTSW 4 103,019,725 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGATAAGGTCCCACGCCAG -3'
(R):5'- GGTCTGCTAGAGTCTAATCCTCAG -3'

Sequencing Primer
(F):5'- ACGCCAGTTCGAAGAGC -3'
(R):5'- TGCTAGAGTCTAATCCTCAGAAAGC -3'
Posted On 2015-11-11