Incidental Mutation 'R4728:Sema3f'
ID358613
Institutional Source Beutler Lab
Gene Symbol Sema3f
Ensembl Gene ENSMUSG00000034684
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
SynonymsSema IV, Semak
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4728 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107681500-107710475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107705440 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 35 (S35P)
Ref Sequence ENSEMBL: ENSMUSP00000142221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080560] [ENSMUST00000192727] [ENSMUST00000193108] [ENSMUST00000194039]
Predicted Effect probably benign
Transcript: ENSMUST00000080560
AA Change: S35P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684
AA Change: S35P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192727
AA Change: S35P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141865
Gene: ENSMUSG00000034684
AA Change: S35P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 529 3.31e-205 SMART
PSI 547 599 1.87e-12 SMART
IGc2 617 685 3.79e-4 SMART
low complexity region 704 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193108
AA Change: S35P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141878
Gene: ENSMUSG00000034684
AA Change: S35P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 191 9.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194039
AA Change: S35P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142221
Gene: ENSMUSG00000034684
AA Change: S35P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 185 2e-42 PFAM
Meta Mutation Damage Score 0.1381 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin loop and a C-terminal basic domain. This gene is expressed by the endothelial cells where it was found to act in an autocrine fashion to induce apoptosis, inhibit cell proliferation and survival, and function as an anti-tumorigenic agent. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Inactivation of this locus results in neuronal defects including impaired CNS axon pathfinding, and PNS and limbic system circuitry. Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,935,831 probably null Het
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh5 A T 12: 75,007,781 I463N probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Kmo A G 1: 175,656,763 D353G possibly damaging Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Napb T C 2: 148,709,325 D96G probably damaging Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Olfr1152 T C 2: 87,868,435 V148A probably benign Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pcx G T 19: 4,603,096 R263L probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Snrnp200 T C 2: 127,217,414 L409P probably damaging Het
Snrnp200 T A 2: 127,227,878 V981E possibly damaging Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Sema3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Sema3f APN 9 107685522 missense probably benign 0.44
IGL01940:Sema3f APN 9 107683697 unclassified probably benign
IGL02070:Sema3f APN 9 107692241 missense probably damaging 1.00
IGL02381:Sema3f APN 9 107692395 missense probably damaging 1.00
IGL02472:Sema3f APN 9 107687736 missense probably damaging 1.00
IGL02557:Sema3f APN 9 107687212 missense probably damaging 1.00
IGL02614:Sema3f APN 9 107682511 missense probably benign 0.28
IGL02660:Sema3f APN 9 107683984 missense probably benign 0.05
R1468:Sema3f UTSW 9 107687572 unclassified probably benign
R1905:Sema3f UTSW 9 107684376 missense probably damaging 1.00
R4772:Sema3f UTSW 9 107689720 nonsense probably null
R4786:Sema3f UTSW 9 107682682 missense probably benign 0.45
R4845:Sema3f UTSW 9 107685501 missense probably damaging 1.00
R5418:Sema3f UTSW 9 107692621 missense probably damaging 1.00
R5780:Sema3f UTSW 9 107682589 missense probably damaging 0.98
R5849:Sema3f UTSW 9 107682616 missense probably damaging 0.98
R5929:Sema3f UTSW 9 107692193 missense probably damaging 1.00
R6968:Sema3f UTSW 9 107691449 critical splice acceptor site probably null
R7043:Sema3f UTSW 9 107691400 missense possibly damaging 0.91
R7449:Sema3f UTSW 9 107684036 missense probably damaging 1.00
R7526:Sema3f UTSW 9 107689728 missense probably damaging 0.96
R7559:Sema3f UTSW 9 107684578 missense possibly damaging 0.52
R7771:Sema3f UTSW 9 107692426 missense possibly damaging 0.89
R7789:Sema3f UTSW 9 107705432 missense probably benign 0.00
R8058:Sema3f UTSW 9 107682601
Predicted Primers PCR Primer
(F):5'- AGGACCCTCTCTCAAAATATCTCAG -3'
(R):5'- GCTGCATACGGAAATGGCTC -3'

Sequencing Primer
(F):5'- TCAAAATATCTCAGTCCTCAGTGC -3'
(R):5'- GAAATGGCTCACACATTCCAACTTTG -3'
Posted On2015-11-11