Incidental Mutation 'R4728:Bicc1'
ID358615
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4728 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 70935831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably null
Transcript: ENSMUST00000014473
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058942
Predicted Effect probably null
Transcript: ENSMUST00000131445
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143791
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218757
Meta Mutation Damage Score 0.9713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh5 A T 12: 75,007,781 I463N probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Kmo A G 1: 175,656,763 D353G possibly damaging Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Napb T C 2: 148,709,325 D96G probably damaging Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Olfr1152 T C 2: 87,868,435 V148A probably benign Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pcx G T 19: 4,603,096 R263L probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Sema3f A G 9: 107,705,440 S35P probably benign Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Snrnp200 T C 2: 127,217,414 L409P probably damaging Het
Snrnp200 T A 2: 127,227,878 V981E possibly damaging Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGAGTGCCCTTGACAG -3'
(R):5'- ACATTGTGTGGCATCGTCTG -3'

Sequencing Primer
(F):5'- CCTTGACAGGGAGGAATCAG -3'
(R):5'- CTCTGAGATGTCTACTTTGTTGAAC -3'
Posted On2015-11-11