Incidental Mutation 'R0321:Kdm8'
ID 35862
Institutional Source Beutler Lab
Gene Symbol Kdm8
Ensembl Gene ENSMUSG00000030752
Gene Name lysine (K)-specific demethylase 8
Synonyms
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0321 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 125444676-125462269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125461006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 360 (Q360L)
Ref Sequence ENSEMBL: ENSMUSP00000033010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033010] [ENSMUST00000135129]
AlphaFold Q9CXT6
Predicted Effect probably damaging
Transcript: ENSMUST00000033010
AA Change: Q360L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033010
Gene: ENSMUSG00000030752
AA Change: Q360L

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
JmjC 269 414 2.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135129
SMART Domains Protein: ENSMUSP00000114890
Gene: ENSMUSG00000030752

DomainStartEndE-ValueType
Pfam:Cupin_8 13 152 1.4e-22 PFAM
Meta Mutation Damage Score 0.4034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a histone lysine demethylase. Studies of a similar protein in mouse indicate a potential role for this protein as a tumor suppressor. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality during organogenesis associated with severe growth retardation and abnormal embryo turning. Observed phenotypes include open neural tubes and absent vitelline blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Kdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Kdm8 APN 7 125461205 missense probably damaging 1.00
IGL01975:Kdm8 APN 7 125452357 missense probably benign 0.04
IGL02019:Kdm8 APN 7 125452486 missense probably damaging 0.98
IGL03387:Kdm8 APN 7 125455106 missense probably benign 0.00
R0479:Kdm8 UTSW 7 125452640 missense probably damaging 1.00
R1995:Kdm8 UTSW 7 125452339 missense probably benign 0.00
R4058:Kdm8 UTSW 7 125456494 missense probably damaging 1.00
R4760:Kdm8 UTSW 7 125455259 critical splice donor site probably null
R5683:Kdm8 UTSW 7 125455173 missense possibly damaging 0.93
R6876:Kdm8 UTSW 7 125452658 missense probably benign 0.00
R7189:Kdm8 UTSW 7 125460931 missense probably damaging 1.00
R9154:Kdm8 UTSW 7 125455124 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGAGCACTCTCAGAACGTCAG -3'
(R):5'- AGCGCACATAATGCCAGTACTTAGC -3'

Sequencing Primer
(F):5'- TCTCAGAACGTCAGAGCTTG -3'
(R):5'- TGCCAGTACTTAGCAGGTATAAAG -3'
Posted On 2013-05-09