Incidental Mutation 'R4728:Kcnh5'
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 5
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4728 (G1)
Quality Score225
Status Validated
Chromosomal Location74897220-75177332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75007781 bp
Amino Acid Change Isoleucine to Asparagine at position 463 (I463N)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
Predicted Effect probably damaging
Transcript: ENSMUST00000042299
AA Change: I463N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: I463N

PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Meta Mutation Damage Score 0.9110 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,935,831 probably null Het
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Kmo A G 1: 175,656,763 D353G possibly damaging Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Napb T C 2: 148,709,325 D96G probably damaging Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Olfr1152 T C 2: 87,868,435 V148A probably benign Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pcx G T 19: 4,603,096 R263L probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Sema3f A G 9: 107,705,440 S35P probably benign Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Snrnp200 T C 2: 127,217,414 L409P probably damaging Het
Snrnp200 T A 2: 127,227,878 V981E possibly damaging Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74897796 missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75114189 critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74898397 missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75007676 missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75114346 missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75007625 missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 74976493 missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74898327 missense probably benign 0.05
IGL01642:Kcnh5 APN 12 74965169 missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75114500 nonsense probably null
IGL01733:Kcnh5 APN 12 74965192 missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74897548 missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75087605 missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74897652 missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75176538 utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 74976697 missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75007665 missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75114397 missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75114414 missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75137673 missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75114549 missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 74965261 missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75119937 missense probably benign
R1728:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75114229 missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74898456 critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75130931 missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75114471 missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75114540 missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75087576 missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74898270 missense probably benign
R4681:Kcnh5 UTSW 12 75007623 missense probably benign 0.00
R4965:Kcnh5 UTSW 12 74965151 missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74898084 missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75087416 missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75130907 missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 74976689 missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75137649 missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74898420 missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75087591 missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75007658 missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75007611 missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75114445 missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74897709 missense probably benign 0.10
R7437:Kcnh5 UTSW 12 75137643 critical splice donor site probably null
R7557:Kcnh5 UTSW 12 75007625 missense possibly damaging 0.62
R7566:Kcnh5 UTSW 12 75114392 nonsense probably null
R7591:Kcnh5 UTSW 12 75007767 missense probably benign 0.24
R7781:Kcnh5 UTSW 12 74976681 missense probably damaging 0.99
R7816:Kcnh5 UTSW 12 74976683 missense probably damaging 1.00
R8152:Kcnh5 UTSW 12 74897859 missense possibly damaging 0.68
R8390:Kcnh5 UTSW 12 75087758 missense probably damaging 1.00
R8560:Kcnh5 UTSW 12 74976605 missense probably damaging 1.00
Z1088:Kcnh5 UTSW 12 74897761 missense probably benign 0.00
Z1088:Kcnh5 UTSW 12 74965295 missense possibly damaging 0.78
Z1177:Kcnh5 UTSW 12 75007797 missense possibly damaging 0.90
Z1177:Kcnh5 UTSW 12 75114522 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-11-11