Incidental Mutation 'R4728:Pcx'
ID358643
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Namepyruvate carboxylase
SynonymsPc
MMRRC Submission 042020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4728 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4510472-4621752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4603096 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 263 (R263L)
Ref Sequence ENSEMBL: ENSMUSP00000153479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068004] [ENSMUST00000113825] [ENSMUST00000224726] [ENSMUST00000225189]
Predicted Effect probably damaging
Transcript: ENSMUST00000068004
AA Change: R264L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: R264L

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113825
AA Change: R263L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: R263L

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224726
AA Change: R263L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225189
Meta Mutation Damage Score 0.9741 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 C T 10: 70,935,831 probably null Het
Bpifc T A 10: 85,991,199 H162L possibly damaging Het
Ccdc163 C T 4: 116,709,012 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cyth4 G A 15: 78,602,713 G14R probably benign Het
Ddhd2 C T 8: 25,752,267 V194I probably damaging Het
Ddx23 A T 15: 98,650,225 V433E probably damaging Het
Defb34 A G 8: 19,126,418 N42D possibly damaging Het
Dennd6a A G 14: 26,627,420 E313G probably null Het
Dhx30 A G 9: 110,087,650 F570S probably damaging Het
Dnah3 T C 7: 120,059,366 E864G probably damaging Het
Eps8 G A 6: 137,509,162 Q451* probably null Het
Fmo9 A T 1: 166,663,311 Y533N possibly damaging Het
Fut8 T A 12: 77,475,199 D537E probably damaging Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm9916 A G 3: 118,435,041 noncoding transcript Het
Grm5 T A 7: 87,975,288 F354L probably damaging Het
Hira C T 16: 18,922,904 A353V probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Igf1r T C 7: 68,189,624 L628P probably damaging Het
Kcnh5 A T 12: 75,007,781 I463N probably damaging Het
Kcnh8 C A 17: 52,725,870 Q62K probably damaging Het
Kif3c A T 12: 3,365,873 probably benign Het
Kmo A G 1: 175,656,763 D353G possibly damaging Het
Lrp1 T C 10: 127,563,737 T2301A probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Map3k9 C T 12: 81,722,373 R967Q probably damaging Het
Mcm8 A G 2: 132,832,854 H414R probably damaging Het
Mier1 A G 4: 103,140,205 E145G probably damaging Het
Mlc1 A T 15: 88,978,031 probably null Het
Napb T C 2: 148,709,325 D96G probably damaging Het
Nbas T A 12: 13,288,739 S193R probably damaging Het
Nlrp4a T C 7: 26,475,090 V967A probably benign Het
Nlrp4e T A 7: 23,321,564 I492K probably benign Het
Notch4 A G 17: 34,570,205 T497A probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ogdh T A 11: 6,342,549 Y417N probably damaging Het
Olfr1152 T C 2: 87,868,435 V148A probably benign Het
Ovol1 A T 19: 5,553,662 Y70* probably null Het
P2ry1 A G 3: 61,004,220 Y260C probably damaging Het
Pla2g4f T A 2: 120,300,921 T774S probably benign Het
Prdm15 T G 16: 97,821,786 K289Q probably benign Het
Prl7c1 A T 13: 27,776,285 H91Q probably benign Het
Prmt5 C T 14: 54,507,907 R601H probably benign Het
Prrc2b T A 2: 32,230,625 D2192E probably damaging Het
Ptdss2 A G 7: 141,154,459 I299V probably benign Het
Rbm28 A G 6: 29,143,592 V354A probably damaging Het
Rps6kb1 G C 11: 86,544,658 probably null Het
Sema3f A G 9: 107,705,440 S35P probably benign Het
Serpina3n A T 12: 104,409,163 T165S probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh2d4b T A 14: 40,842,432 R267* probably null Het
Slc5a12 A T 2: 110,644,424 K554* probably null Het
Snrnp200 T C 2: 127,217,414 L409P probably damaging Het
Snrnp200 T A 2: 127,227,878 V981E possibly damaging Het
Spon2 T A 5: 33,217,338 R41S probably benign Het
Sptb A T 12: 76,583,379 M2279K probably benign Het
Srcap T G 7: 127,540,924 probably null Het
Tctn3 A G 19: 40,605,742 V409A probably damaging Het
Tg A C 15: 66,682,827 Q697P probably damaging Het
Tmem181a A G 17: 6,290,599 D141G probably benign Het
Tmem82 A G 4: 141,614,652 S334P probably benign Het
Ubr4 A G 4: 139,423,879 Y1875C probably damaging Het
Vmn1r63 C A 7: 5,803,363 R90L probably damaging Het
Zfp330 A C 8: 82,770,846 Y56D probably damaging Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 unclassified probably null
IGL01373:Pcx APN 19 4620235 unclassified probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1543:Pcx UTSW 19 4602223 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2172:Pcx UTSW 19 4620881 missense probably benign 0.17
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4409:Pcx UTSW 19 4610003 missense possibly damaging 0.65
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5621:Pcx UTSW 19 4619167 missense possibly damaging 0.59
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
R7202:Pcx UTSW 19 4602333 missense possibly damaging 0.47
R7423:Pcx UTSW 19 4621178 missense probably benign 0.00
R7473:Pcx UTSW 19 4619561 nonsense probably null
R7654:Pcx UTSW 19 4515669 utr 5 prime probably null
Z1176:Pcx UTSW 19 4619073 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCTCCCCGGTTTACAGTAGC -3'
(R):5'- TTTCAACAGGCTGTCTACAGGG -3'

Sequencing Primer
(F):5'- TTACAGTAGCCACCTTTGGGACAG -3'
(R):5'- GCTGTCTACAGGGAGTTTCCAAAC -3'
Posted On2015-11-11