Incidental Mutation 'R4729:Snrnp200'
ID358659
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Namesmall nuclear ribonucleoprotein 200 (U5)
SynonymsHELIC2, U5-200KD, A330064G03Rik, Ascc3l1
MMRRC Submission 041603-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4729 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127208386-127240451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127232937 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1477 (I1477F)
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103220]
Predicted Effect probably damaging
Transcript: ENSMUST00000103220
AA Change: I1477F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660
AA Change: I1477F

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143481
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,849,323 L220H unknown Het
Amt T A 9: 108,300,652 L272Q probably damaging Het
Ank2 G C 3: 126,976,896 Y894* probably null Het
Ankzf1 T A 1: 75,194,264 F105I probably damaging Het
Aox4 C A 1: 58,259,077 Y1067* probably null Het
BC034090 T A 1: 155,225,090 Q476L probably damaging Het
Bhmt G T 13: 93,627,363 R57S probably damaging Het
Cacna1c A T 6: 118,656,175 F964L probably damaging Het
Celsr3 A C 9: 108,847,652 S396R probably benign Het
Cpne4 C A 9: 104,922,556 Q191K probably damaging Het
Csnk1g2 T C 10: 80,639,204 Y352H probably benign Het
D630003M21Rik A G 2: 158,216,703 S426P probably damaging Het
Dido1 G T 2: 180,687,650 N326K probably benign Het
E2f2 T A 4: 136,184,449 I257N probably damaging Het
Elfn1 T G 5: 139,973,658 F806V probably damaging Het
Eml6 T A 11: 29,833,204 Y559F probably damaging Het
Erich6 A G 3: 58,636,059 probably null Het
Fam45a T A 19: 60,834,871 F315I probably benign Het
Fam78a T C 2: 32,082,605 N101S probably damaging Het
Fam83h A G 15: 76,002,336 S1051P probably benign Het
Galns C T 8: 122,603,456 G112D probably damaging Het
Gm7075 A T 10: 63,421,465 V92E probably damaging Het
Gm9923 A G 10: 72,309,694 K125R probably damaging Het
Hectd3 G A 4: 116,997,218 V326M probably damaging Het
Iars2 A G 1: 185,316,051 S495P possibly damaging Het
Ice1 T C 13: 70,606,384 R528G probably damaging Het
Igkv12-38 T A 6: 69,943,384 Y50F possibly damaging Het
Inpp5j T C 11: 3,495,025 S883G probably damaging Het
Irf8 T C 8: 120,753,439 S139P probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kcnq4 G T 4: 120,713,074 D357E possibly damaging Het
Klhl1 A G 14: 96,280,148 L364P probably damaging Het
Krt7 A G 15: 101,420,558 I309V probably benign Het
Krt76 G T 15: 101,889,081 A281D probably damaging Het
Lancl2 T C 6: 57,737,712 F430L probably damaging Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc26 A T 2: 25,290,064 T26S probably benign Het
Lrrk1 T A 7: 66,262,293 M1840L probably benign Het
Lyst G A 13: 13,637,901 C966Y probably damaging Het
Mad1l1 T A 5: 140,261,511 S354C possibly damaging Het
Mbtps1 C T 8: 119,525,420 G577D probably damaging Het
Mycbp2 C T 14: 103,188,591 R2366H probably damaging Het
Myo18a T G 11: 77,777,685 probably null Het
Naip5 G A 13: 100,222,131 R866C possibly damaging Het
Nav2 T A 7: 49,452,819 V455E probably benign Het
Neb A G 2: 52,263,662 I2417T possibly damaging Het
Nme5 C T 18: 34,569,837 A133T probably benign Het
Nradd T C 9: 110,621,911 D51G possibly damaging Het
Pard3b A G 1: 62,211,684 R591G probably damaging Het
Pcbp4 T C 9: 106,460,730 F73S probably damaging Het
Pcdhb11 C T 18: 37,422,366 Q250* probably null Het
Pde1c T A 6: 56,072,209 K766N probably damaging Het
Phf21b G A 15: 84,854,741 Q40* probably null Het
Prr14 A G 7: 127,474,696 D244G probably benign Het
Rab11fip5 C T 6: 85,374,267 A88T probably damaging Het
Rad54l2 A T 9: 106,716,118 S428T probably benign Het
Rdh9 A G 10: 127,776,752 I90V probably benign Het
Rhag G T 17: 40,828,401 G76C probably damaging Het
Riok3 T A 18: 12,128,927 V6E possibly damaging Het
Scn10a A G 9: 119,671,526 I229T probably damaging Het
Slco1a1 G T 6: 141,908,969 T652K probably benign Het
Slit1 T A 19: 41,647,020 I345F probably damaging Het
Snx31 G A 15: 36,523,552 T328I possibly damaging Het
Strn A G 17: 78,657,961 F634S probably damaging Het
Tmem101 C T 11: 102,156,329 G6R probably benign Het
Tmem199 C G 11: 78,508,680 G131R probably benign Het
Trim66 A G 7: 109,456,060 probably null Het
Ttn G T 2: 76,851,585 probably benign Het
Upk3bl T C 5: 136,057,393 L61P probably benign Het
Vmn2r108 A G 17: 20,472,370 Y75H probably damaging Het
Vmn2r91 T A 17: 18,107,644 I500K probably damaging Het
Vps18 C T 2: 119,293,791 R400C probably damaging Het
Zeb1 C T 18: 5,767,286 P599L probably damaging Het
Zfhx4 G T 3: 5,399,497 A1572S probably damaging Het
Zfp677 T A 17: 21,397,418 C246S possibly damaging Het
Zfp719 T A 7: 43,590,410 I474N probably damaging Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127228238 splice site probably benign
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127227878 missense possibly damaging 0.89
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127210735 missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127222161 nonsense probably null
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127221827 missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127217272 missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127221826 missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127226484 critical splice donor site probably null
R7587:Snrnp200 UTSW 2 127227902 missense probably damaging 1.00
R7672:Snrnp200 UTSW 2 127221902 missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127229102 missense probably benign
R7841:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7863:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
R7924:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7946:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
RF016:Snrnp200 UTSW 2 127230556 missense probably damaging 1.00
Z1176:Snrnp200 UTSW 2 127234975 missense probably benign 0.10
Z1177:Snrnp200 UTSW 2 127236031 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCACAAAGATTTCAGCCTATTGCC -3'
(R):5'- AGGAATGAAGGCTGTCCTACC -3'

Sequencing Primer
(F):5'- GCCTATTGCCTTATTTCAAAAGAGTG -3'
(R):5'- CTACCTGGATGTGCAGTTCCAAAG -3'
Posted On2015-11-11