Incidental Mutation 'R4729:Slco1a1'
ID358677
Institutional Source Beutler Lab
Gene Symbol Slco1a1
Ensembl Gene ENSMUSG00000041698
Gene Namesolute carrier organic anion transporter family, member 1a1
SynonymsOatp1, Slc21a1, Oatp1a1
MMRRC Submission 041603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R4729 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141907282-141946962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 141908969 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 652 (T652K)
Ref Sequence ENSEMBL: ENSMUSP00000037022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042119] [ENSMUST00000168119]
Predicted Effect probably benign
Transcript: ENSMUST00000042119
AA Change: T652K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037022
Gene: ENSMUSG00000041698
AA Change: T652K

DomainStartEndE-ValueType
Pfam:OATP 21 597 6e-168 PFAM
Pfam:MFS_1 22 410 4.7e-28 PFAM
Pfam:Kazal_2 445 486 1.2e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168119
SMART Domains Protein: ENSMUSP00000132386
Gene: ENSMUSG00000041698

DomainStartEndE-ValueType
Pfam:OATP 21 597 1.6e-168 PFAM
Pfam:MFS_1 22 410 1e-27 PFAM
Pfam:Kazal_2 445 486 4.6e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,849,323 L220H unknown Het
Amt T A 9: 108,300,652 L272Q probably damaging Het
Ank2 G C 3: 126,976,896 Y894* probably null Het
Ankzf1 T A 1: 75,194,264 F105I probably damaging Het
Aox4 C A 1: 58,259,077 Y1067* probably null Het
BC034090 T A 1: 155,225,090 Q476L probably damaging Het
Bhmt G T 13: 93,627,363 R57S probably damaging Het
Cacna1c A T 6: 118,656,175 F964L probably damaging Het
Celsr3 A C 9: 108,847,652 S396R probably benign Het
Cpne4 C A 9: 104,922,556 Q191K probably damaging Het
Csnk1g2 T C 10: 80,639,204 Y352H probably benign Het
D630003M21Rik A G 2: 158,216,703 S426P probably damaging Het
Dido1 G T 2: 180,687,650 N326K probably benign Het
E2f2 T A 4: 136,184,449 I257N probably damaging Het
Elfn1 T G 5: 139,973,658 F806V probably damaging Het
Eml6 T A 11: 29,833,204 Y559F probably damaging Het
Erich6 A G 3: 58,636,059 probably null Het
Fam45a T A 19: 60,834,871 F315I probably benign Het
Fam78a T C 2: 32,082,605 N101S probably damaging Het
Fam83h A G 15: 76,002,336 S1051P probably benign Het
Galns C T 8: 122,603,456 G112D probably damaging Het
Gm7075 A T 10: 63,421,465 V92E probably damaging Het
Gm9923 A G 10: 72,309,694 K125R probably damaging Het
Hectd3 G A 4: 116,997,218 V326M probably damaging Het
Iars2 A G 1: 185,316,051 S495P possibly damaging Het
Ice1 T C 13: 70,606,384 R528G probably damaging Het
Igkv12-38 T A 6: 69,943,384 Y50F possibly damaging Het
Inpp5j T C 11: 3,495,025 S883G probably damaging Het
Irf8 T C 8: 120,753,439 S139P probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kcnq4 G T 4: 120,713,074 D357E possibly damaging Het
Klhl1 A G 14: 96,280,148 L364P probably damaging Het
Krt7 A G 15: 101,420,558 I309V probably benign Het
Krt76 G T 15: 101,889,081 A281D probably damaging Het
Lancl2 T C 6: 57,737,712 F430L probably damaging Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc26 A T 2: 25,290,064 T26S probably benign Het
Lrrk1 T A 7: 66,262,293 M1840L probably benign Het
Lyst G A 13: 13,637,901 C966Y probably damaging Het
Mad1l1 T A 5: 140,261,511 S354C possibly damaging Het
Mbtps1 C T 8: 119,525,420 G577D probably damaging Het
Mycbp2 C T 14: 103,188,591 R2366H probably damaging Het
Myo18a T G 11: 77,777,685 probably null Het
Naip5 G A 13: 100,222,131 R866C possibly damaging Het
Nav2 T A 7: 49,452,819 V455E probably benign Het
Neb A G 2: 52,263,662 I2417T possibly damaging Het
Nme5 C T 18: 34,569,837 A133T probably benign Het
Nradd T C 9: 110,621,911 D51G possibly damaging Het
Pard3b A G 1: 62,211,684 R591G probably damaging Het
Pcbp4 T C 9: 106,460,730 F73S probably damaging Het
Pcdhb11 C T 18: 37,422,366 Q250* probably null Het
Pde1c T A 6: 56,072,209 K766N probably damaging Het
Phf21b G A 15: 84,854,741 Q40* probably null Het
Prr14 A G 7: 127,474,696 D244G probably benign Het
Rab11fip5 C T 6: 85,374,267 A88T probably damaging Het
Rad54l2 A T 9: 106,716,118 S428T probably benign Het
Rdh9 A G 10: 127,776,752 I90V probably benign Het
Rhag G T 17: 40,828,401 G76C probably damaging Het
Riok3 T A 18: 12,128,927 V6E possibly damaging Het
Scn10a A G 9: 119,671,526 I229T probably damaging Het
Slit1 T A 19: 41,647,020 I345F probably damaging Het
Snrnp200 A T 2: 127,232,937 I1477F probably damaging Het
Snx31 G A 15: 36,523,552 T328I possibly damaging Het
Strn A G 17: 78,657,961 F634S probably damaging Het
Tmem101 C T 11: 102,156,329 G6R probably benign Het
Tmem199 C G 11: 78,508,680 G131R probably benign Het
Trim66 A G 7: 109,456,060 probably null Het
Ttn G T 2: 76,851,585 probably benign Het
Upk3bl T C 5: 136,057,393 L61P probably benign Het
Vmn2r108 A G 17: 20,472,370 Y75H probably damaging Het
Vmn2r91 T A 17: 18,107,644 I500K probably damaging Het
Vps18 C T 2: 119,293,791 R400C probably damaging Het
Zeb1 C T 18: 5,767,286 P599L probably damaging Het
Zfhx4 G T 3: 5,399,497 A1572S probably damaging Het
Zfp677 T A 17: 21,397,418 C246S possibly damaging Het
Zfp719 T A 7: 43,590,410 I474N probably damaging Het
Other mutations in Slco1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slco1a1 APN 6 141909125 missense probably damaging 0.98
IGL00942:Slco1a1 APN 6 141946628 missense probably benign 0.00
IGL01301:Slco1a1 APN 6 141932530 splice site probably benign
IGL01306:Slco1a1 APN 6 141946587 nonsense probably null
IGL01774:Slco1a1 APN 6 141925613 nonsense probably null
IGL02097:Slco1a1 APN 6 141940039 missense possibly damaging 0.94
IGL02183:Slco1a1 APN 6 141921943 splice site probably benign
IGL02376:Slco1a1 APN 6 141924334 critical splice donor site probably null
IGL02550:Slco1a1 APN 6 141943465 missense probably benign 0.24
IGL02559:Slco1a1 APN 6 141921788 missense probably benign 0.01
IGL02825:Slco1a1 APN 6 141918617 missense probably damaging 1.00
IGL03352:Slco1a1 APN 6 141911885 missense probably benign 0.00
ANU23:Slco1a1 UTSW 6 141946587 nonsense probably null
R0041:Slco1a1 UTSW 6 141918459 splice site probably benign
R0153:Slco1a1 UTSW 6 141910701 splice site probably benign
R0610:Slco1a1 UTSW 6 141918461 critical splice donor site probably null
R0646:Slco1a1 UTSW 6 141925754 splice site probably benign
R0828:Slco1a1 UTSW 6 141921839 missense possibly damaging 0.89
R1674:Slco1a1 UTSW 6 141935935 missense probably damaging 0.99
R1848:Slco1a1 UTSW 6 141923111 missense probably benign 0.29
R3834:Slco1a1 UTSW 6 141943437 missense possibly damaging 0.94
R3953:Slco1a1 UTSW 6 141923107 missense probably damaging 1.00
R3974:Slco1a1 UTSW 6 141909093 missense probably benign 0.01
R4081:Slco1a1 UTSW 6 141935962 missense probably damaging 0.99
R4752:Slco1a1 UTSW 6 141946614 missense possibly damaging 0.80
R4806:Slco1a1 UTSW 6 141909009 missense possibly damaging 0.76
R4812:Slco1a1 UTSW 6 141918593 missense probably damaging 1.00
R4963:Slco1a1 UTSW 6 141923099 missense probably benign 0.26
R5641:Slco1a1 UTSW 6 141939969 missense probably damaging 1.00
R6044:Slco1a1 UTSW 6 141940017 missense probably benign 0.01
R6211:Slco1a1 UTSW 6 141909049 missense probably benign 0.20
R6225:Slco1a1 UTSW 6 141924489 missense possibly damaging 0.70
R6328:Slco1a1 UTSW 6 141932450 missense probably damaging 1.00
R6428:Slco1a1 UTSW 6 141925690 missense probably damaging 1.00
R6787:Slco1a1 UTSW 6 141936487 missense probably benign 0.00
R7182:Slco1a1 UTSW 6 141911839 missense probably damaging 1.00
R7305:Slco1a1 UTSW 6 141924497 missense probably damaging 1.00
R7328:Slco1a1 UTSW 6 141936408 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGTCACCGTAGATGTCTAATCTG -3'
(R):5'- TTTTCAATAGGCACATTTACCTGGG -3'

Sequencing Primer
(F):5'- CCTTAATGTTCTGAAACTGCTATCAG -3'
(R):5'- GCACATTTACCTGGGGTTGCC -3'
Posted On2015-11-11