Incidental Mutation 'R0321:Pik3r4'
ID35868
Institutional Source Beutler Lab
Gene Symbol Pik3r4
Ensembl Gene ENSMUSG00000032571
Gene Namephosphoinositide-3-kinase regulatory subunit 4
SynonymsD9Ertd418e, 2210010O15Rik, C730038E05Rik
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0321 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105642978-105687657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105648707 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 259 (F259I)
Ref Sequence ENSEMBL: ENSMUSP00000139427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000188784] [ENSMUST00000190358] [ENSMUST00000191268]
Predicted Effect probably damaging
Transcript: ENSMUST00000065778
AA Change: F259I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: F259I

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187573
Predicted Effect probably damaging
Transcript: ENSMUST00000188784
AA Change: F259I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140988
Gene: ENSMUSG00000032571
AA Change: F259I

DomainStartEndE-ValueType
S_TKc 26 301 2.8e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190358
SMART Domains Protein: ENSMUSP00000139643
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
S_TKc 26 174 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191117
Predicted Effect probably damaging
Transcript: ENSMUST00000191268
AA Change: F259I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: F259I

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Meta Mutation Damage Score 0.6811 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Pik3r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pik3r4 APN 9 105644604 missense possibly damaging 0.75
IGL01617:Pik3r4 APN 9 105654965 missense probably benign 0.33
IGL01764:Pik3r4 APN 9 105685122 splice site probably benign
IGL01817:Pik3r4 APN 9 105650822 missense probably damaging 1.00
IGL01830:Pik3r4 APN 9 105644955 missense probably damaging 1.00
IGL01905:Pik3r4 APN 9 105644878 nonsense probably null
IGL01947:Pik3r4 APN 9 105686150 missense possibly damaging 0.91
IGL01985:Pik3r4 APN 9 105663045 missense probably benign 0.03
IGL02321:Pik3r4 APN 9 105644478 missense probably benign 0.04
IGL02389:Pik3r4 APN 9 105650331 missense possibly damaging 0.88
IGL02898:Pik3r4 APN 9 105650406 missense probably benign 0.21
IGL03037:Pik3r4 APN 9 105650813 missense probably damaging 1.00
boteh UTSW 9 105667938 splice site probably null
IGL02835:Pik3r4 UTSW 9 105672706 missense probably benign 0.07
R0011:Pik3r4 UTSW 9 105644637 missense probably benign 0.01
R0312:Pik3r4 UTSW 9 105686210 missense probably damaging 1.00
R0482:Pik3r4 UTSW 9 105669045 missense probably benign 0.04
R0645:Pik3r4 UTSW 9 105669187 splice site probably benign
R0690:Pik3r4 UTSW 9 105653976 missense possibly damaging 0.81
R0789:Pik3r4 UTSW 9 105685167 missense probably benign 0.14
R0894:Pik3r4 UTSW 9 105667771 missense possibly damaging 0.73
R0988:Pik3r4 UTSW 9 105687205 missense probably damaging 0.97
R1123:Pik3r4 UTSW 9 105663129 missense probably benign
R1172:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1174:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1342:Pik3r4 UTSW 9 105650901 critical splice donor site probably null
R1387:Pik3r4 UTSW 9 105644291 missense probably damaging 1.00
R1480:Pik3r4 UTSW 9 105687244 missense probably benign 0.39
R1638:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R1643:Pik3r4 UTSW 9 105687152 missense possibly damaging 0.83
R1995:Pik3r4 UTSW 9 105669165 missense probably benign 0.12
R2037:Pik3r4 UTSW 9 105650335 missense probably benign 0.00
R2165:Pik3r4 UTSW 9 105672785 missense probably benign 0.05
R4210:Pik3r4 UTSW 9 105650758 missense possibly damaging 0.57
R4515:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4519:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4630:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4632:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4732:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4733:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4940:Pik3r4 UTSW 9 105668994 missense probably benign 0.20
R5120:Pik3r4 UTSW 9 105669009 missense probably benign 0.30
R5169:Pik3r4 UTSW 9 105678161 missense probably benign 0.14
R5183:Pik3r4 UTSW 9 105682308 missense possibly damaging 0.87
R5353:Pik3r4 UTSW 9 105667938 splice site probably null
R5463:Pik3r4 UTSW 9 105648731 missense probably damaging 1.00
R5635:Pik3r4 UTSW 9 105667825 missense probably benign 0.01
R5763:Pik3r4 UTSW 9 105669775 missense probably benign 0.01
R5830:Pik3r4 UTSW 9 105644824 nonsense probably null
R6251:Pik3r4 UTSW 9 105654048 missense probably benign
R6468:Pik3r4 UTSW 9 105685190 missense possibly damaging 0.86
R6611:Pik3r4 UTSW 9 105644277 missense probably damaging 0.99
R6642:Pik3r4 UTSW 9 105644646 missense probably benign 0.11
R6821:Pik3r4 UTSW 9 105650606 missense probably damaging 0.98
R7039:Pik3r4 UTSW 9 105676890 missense possibly damaging 0.76
R7144:Pik3r4 UTSW 9 105650584 missense probably damaging 0.98
R7410:Pik3r4 UTSW 9 105650591 missense probably damaging 0.99
R7559:Pik3r4 UTSW 9 105678153 missense probably benign 0.17
R7561:Pik3r4 UTSW 9 105687247 missense possibly damaging 0.94
R7658:Pik3r4 UTSW 9 105644511 missense probably damaging 0.98
R7727:Pik3r4 UTSW 9 105669882 missense probably damaging 0.99
R7871:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
R7954:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGACCAAGCCCTTAGACCTAC -3'
(R):5'- CCGTTACTGTGCTCTGCTAAATGCC -3'

Sequencing Primer
(F):5'- AGCCCTTAGACCTACATTGC -3'
(R):5'- atgtcttgcctgtcatccc -3'
Posted On2013-05-09