Incidental Mutation 'R4729:Lrrk1'
ID358681
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission 041603-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4729 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66262293 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1840 (M1840L)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]
Predicted Effect probably benign
Transcript: ENSMUST00000015277
AA Change: M1840L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: M1840L

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137181
Predicted Effect probably benign
Transcript: ENSMUST00000145954
SMART Domains Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
Pfam:Pkinase 158 435 6.6e-46 PFAM
Pfam:Pkinase_Tyr 159 435 5.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167705
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,849,323 L220H unknown Het
Amt T A 9: 108,300,652 L272Q probably damaging Het
Ank2 G C 3: 126,976,896 Y894* probably null Het
Ankzf1 T A 1: 75,194,264 F105I probably damaging Het
Aox4 C A 1: 58,259,077 Y1067* probably null Het
BC034090 T A 1: 155,225,090 Q476L probably damaging Het
Bhmt G T 13: 93,627,363 R57S probably damaging Het
Cacna1c A T 6: 118,656,175 F964L probably damaging Het
Celsr3 A C 9: 108,847,652 S396R probably benign Het
Cpne4 C A 9: 104,922,556 Q191K probably damaging Het
Csnk1g2 T C 10: 80,639,204 Y352H probably benign Het
D630003M21Rik A G 2: 158,216,703 S426P probably damaging Het
Dido1 G T 2: 180,687,650 N326K probably benign Het
E2f2 T A 4: 136,184,449 I257N probably damaging Het
Elfn1 T G 5: 139,973,658 F806V probably damaging Het
Eml6 T A 11: 29,833,204 Y559F probably damaging Het
Erich6 A G 3: 58,636,059 probably null Het
Fam45a T A 19: 60,834,871 F315I probably benign Het
Fam78a T C 2: 32,082,605 N101S probably damaging Het
Fam83h A G 15: 76,002,336 S1051P probably benign Het
Galns C T 8: 122,603,456 G112D probably damaging Het
Gm7075 A T 10: 63,421,465 V92E probably damaging Het
Gm9923 A G 10: 72,309,694 K125R probably damaging Het
Hectd3 G A 4: 116,997,218 V326M probably damaging Het
Iars2 A G 1: 185,316,051 S495P possibly damaging Het
Ice1 T C 13: 70,606,384 R528G probably damaging Het
Igkv12-38 T A 6: 69,943,384 Y50F possibly damaging Het
Inpp5j T C 11: 3,495,025 S883G probably damaging Het
Irf8 T C 8: 120,753,439 S139P probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kcnq4 G T 4: 120,713,074 D357E possibly damaging Het
Klhl1 A G 14: 96,280,148 L364P probably damaging Het
Krt7 A G 15: 101,420,558 I309V probably benign Het
Krt76 G T 15: 101,889,081 A281D probably damaging Het
Lancl2 T C 6: 57,737,712 F430L probably damaging Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc26 A T 2: 25,290,064 T26S probably benign Het
Lyst G A 13: 13,637,901 C966Y probably damaging Het
Mad1l1 T A 5: 140,261,511 S354C possibly damaging Het
Mbtps1 C T 8: 119,525,420 G577D probably damaging Het
Mycbp2 C T 14: 103,188,591 R2366H probably damaging Het
Myo18a T G 11: 77,777,685 probably null Het
Naip5 G A 13: 100,222,131 R866C possibly damaging Het
Nav2 T A 7: 49,452,819 V455E probably benign Het
Neb A G 2: 52,263,662 I2417T possibly damaging Het
Nme5 C T 18: 34,569,837 A133T probably benign Het
Nradd T C 9: 110,621,911 D51G possibly damaging Het
Pard3b A G 1: 62,211,684 R591G probably damaging Het
Pcbp4 T C 9: 106,460,730 F73S probably damaging Het
Pcdhb11 C T 18: 37,422,366 Q250* probably null Het
Pde1c T A 6: 56,072,209 K766N probably damaging Het
Phf21b G A 15: 84,854,741 Q40* probably null Het
Prr14 A G 7: 127,474,696 D244G probably benign Het
Rab11fip5 C T 6: 85,374,267 A88T probably damaging Het
Rad54l2 A T 9: 106,716,118 S428T probably benign Het
Rdh9 A G 10: 127,776,752 I90V probably benign Het
Rhag G T 17: 40,828,401 G76C probably damaging Het
Riok3 T A 18: 12,128,927 V6E possibly damaging Het
Scn10a A G 9: 119,671,526 I229T probably damaging Het
Slco1a1 G T 6: 141,908,969 T652K probably benign Het
Slit1 T A 19: 41,647,020 I345F probably damaging Het
Snrnp200 A T 2: 127,232,937 I1477F probably damaging Het
Snx31 G A 15: 36,523,552 T328I possibly damaging Het
Strn A G 17: 78,657,961 F634S probably damaging Het
Tmem101 C T 11: 102,156,329 G6R probably benign Het
Tmem199 C G 11: 78,508,680 G131R probably benign Het
Trim66 A G 7: 109,456,060 probably null Het
Ttn G T 2: 76,851,585 probably benign Het
Upk3bl T C 5: 136,057,393 L61P probably benign Het
Vmn2r108 A G 17: 20,472,370 Y75H probably damaging Het
Vmn2r91 T A 17: 18,107,644 I500K probably damaging Het
Vps18 C T 2: 119,293,791 R400C probably damaging Het
Zeb1 C T 18: 5,767,286 P599L probably damaging Het
Zfhx4 G T 3: 5,399,497 A1572S probably damaging Het
Zfp677 T A 17: 21,397,418 C246S possibly damaging Het
Zfp719 T A 7: 43,590,410 I474N probably damaging Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
Savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
R7593:Lrrk1 UTSW 7 66308691 missense probably benign 0.12
R7728:Lrrk1 UTSW 7 66262715 missense probably benign 0.00
R7993:Lrrk1 UTSW 7 66262454 missense probably benign 0.00
R8009:Lrrk1 UTSW 7 66265474 missense possibly damaging 0.82
R8037:Lrrk1 UTSW 7 66285341 missense probably benign
R8101:Lrrk1 UTSW 7 66342782 missense probably benign
R8116:Lrrk1 UTSW 7 66262623 missense possibly damaging 0.95
R8126:Lrrk1 UTSW 7 66292315 missense probably damaging 1.00
R8278:Lrrk1 UTSW 7 66278684 missense probably benign 0.37
RF018:Lrrk1 UTSW 7 66381502 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTCTTTGACAGCAAGCACCTTC -3'
(R):5'- CAGGGACACGTTTTCTGTGC -3'

Sequencing Primer
(F):5'- AGGTGCTGGCTGAACGTCTC -3'
(R):5'- TGTGCAGCCTTCAGTCCTAGAAAC -3'
Posted On2015-11-11