Incidental Mutation 'R4729:Trim66'
ID358682
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Nametripartite motif-containing 66
SynonymsTif1d, D7H11orf29
MMRRC Submission 041603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4729 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109449006-109508134 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 109456060 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
Predicted Effect probably null
Transcript: ENSMUST00000033339
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106739
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106741
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,849,323 L220H unknown Het
Amt T A 9: 108,300,652 L272Q probably damaging Het
Ank2 G C 3: 126,976,896 Y894* probably null Het
Ankzf1 T A 1: 75,194,264 F105I probably damaging Het
Aox4 C A 1: 58,259,077 Y1067* probably null Het
BC034090 T A 1: 155,225,090 Q476L probably damaging Het
Bhmt G T 13: 93,627,363 R57S probably damaging Het
Cacna1c A T 6: 118,656,175 F964L probably damaging Het
Celsr3 A C 9: 108,847,652 S396R probably benign Het
Cpne4 C A 9: 104,922,556 Q191K probably damaging Het
Csnk1g2 T C 10: 80,639,204 Y352H probably benign Het
D630003M21Rik A G 2: 158,216,703 S426P probably damaging Het
Dido1 G T 2: 180,687,650 N326K probably benign Het
E2f2 T A 4: 136,184,449 I257N probably damaging Het
Elfn1 T G 5: 139,973,658 F806V probably damaging Het
Eml6 T A 11: 29,833,204 Y559F probably damaging Het
Erich6 A G 3: 58,636,059 probably null Het
Fam45a T A 19: 60,834,871 F315I probably benign Het
Fam78a T C 2: 32,082,605 N101S probably damaging Het
Fam83h A G 15: 76,002,336 S1051P probably benign Het
Galns C T 8: 122,603,456 G112D probably damaging Het
Gm7075 A T 10: 63,421,465 V92E probably damaging Het
Gm9923 A G 10: 72,309,694 K125R probably damaging Het
Hectd3 G A 4: 116,997,218 V326M probably damaging Het
Iars2 A G 1: 185,316,051 S495P possibly damaging Het
Ice1 T C 13: 70,606,384 R528G probably damaging Het
Igkv12-38 T A 6: 69,943,384 Y50F possibly damaging Het
Inpp5j T C 11: 3,495,025 S883G probably damaging Het
Irf8 T C 8: 120,753,439 S139P probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kcnq4 G T 4: 120,713,074 D357E possibly damaging Het
Klhl1 A G 14: 96,280,148 L364P probably damaging Het
Krt7 A G 15: 101,420,558 I309V probably benign Het
Krt76 G T 15: 101,889,081 A281D probably damaging Het
Lancl2 T C 6: 57,737,712 F430L probably damaging Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc26 A T 2: 25,290,064 T26S probably benign Het
Lrrk1 T A 7: 66,262,293 M1840L probably benign Het
Lyst G A 13: 13,637,901 C966Y probably damaging Het
Mad1l1 T A 5: 140,261,511 S354C possibly damaging Het
Mbtps1 C T 8: 119,525,420 G577D probably damaging Het
Mycbp2 C T 14: 103,188,591 R2366H probably damaging Het
Myo18a T G 11: 77,777,685 probably null Het
Naip5 G A 13: 100,222,131 R866C possibly damaging Het
Nav2 T A 7: 49,452,819 V455E probably benign Het
Neb A G 2: 52,263,662 I2417T possibly damaging Het
Nme5 C T 18: 34,569,837 A133T probably benign Het
Nradd T C 9: 110,621,911 D51G possibly damaging Het
Pard3b A G 1: 62,211,684 R591G probably damaging Het
Pcbp4 T C 9: 106,460,730 F73S probably damaging Het
Pcdhb11 C T 18: 37,422,366 Q250* probably null Het
Pde1c T A 6: 56,072,209 K766N probably damaging Het
Phf21b G A 15: 84,854,741 Q40* probably null Het
Prr14 A G 7: 127,474,696 D244G probably benign Het
Rab11fip5 C T 6: 85,374,267 A88T probably damaging Het
Rad54l2 A T 9: 106,716,118 S428T probably benign Het
Rdh9 A G 10: 127,776,752 I90V probably benign Het
Rhag G T 17: 40,828,401 G76C probably damaging Het
Riok3 T A 18: 12,128,927 V6E possibly damaging Het
Scn10a A G 9: 119,671,526 I229T probably damaging Het
Slco1a1 G T 6: 141,908,969 T652K probably benign Het
Slit1 T A 19: 41,647,020 I345F probably damaging Het
Snrnp200 A T 2: 127,232,937 I1477F probably damaging Het
Snx31 G A 15: 36,523,552 T328I possibly damaging Het
Strn A G 17: 78,657,961 F634S probably damaging Het
Tmem101 C T 11: 102,156,329 G6R probably benign Het
Tmem199 C G 11: 78,508,680 G131R probably benign Het
Ttn G T 2: 76,851,585 probably benign Het
Upk3bl T C 5: 136,057,393 L61P probably benign Het
Vmn2r108 A G 17: 20,472,370 Y75H probably damaging Het
Vmn2r91 T A 17: 18,107,644 I500K probably damaging Het
Vps18 C T 2: 119,293,791 R400C probably damaging Het
Zeb1 C T 18: 5,767,286 P599L probably damaging Het
Zfhx4 G T 3: 5,399,497 A1572S probably damaging Het
Zfp677 T A 17: 21,397,418 C246S possibly damaging Het
Zfp719 T A 7: 43,590,410 I474N probably damaging Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0470:Trim66 UTSW 7 109457542 splice site probably benign
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R3945:Trim66 UTSW 7 109472268 missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6374:Trim66 UTSW 7 109486062 missense probably benign
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6788:Trim66 UTSW 7 109477754 missense probably damaging 1.00
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
RF013:Trim66 UTSW 7 109460753 missense probably damaging 0.99
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AATAATGCCTGGCCTTGGGG -3'
(R):5'- AAACTGCCTTCTTAGGGTGGC -3'

Sequencing Primer
(F):5'- CTGGCCTTGGGGAAGGAG -3'
(R):5'- CTGGCATCCTTGAGGTCAGAG -3'
Posted On2015-11-11