Incidental Mutation 'R0321:Oprm1'
ID 35871
Institutional Source Beutler Lab
Gene Symbol Oprm1
Ensembl Gene ENSMUSG00000000766
Gene Name opioid receptor, mu 1
Synonyms Oprm, MOP receptor, mor, muOR, MOR-1, MOP-R
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0321 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 6758506-7038198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6829183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 131 (S131P)
Ref Sequence ENSEMBL: ENSMUSP00000115413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000783] [ENSMUST00000052751] [ENSMUST00000056385] [ENSMUST00000063036] [ENSMUST00000078634] [ENSMUST00000092729] [ENSMUST00000092731] [ENSMUST00000092734] [ENSMUST00000105597] [ENSMUST00000105601] [ENSMUST00000105602] [ENSMUST00000105603] [ENSMUST00000105604] [ENSMUST00000105605] [ENSMUST00000105607] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000123861] [ENSMUST00000154941] [ENSMUST00000129221] [ENSMUST00000144264] [ENSMUST00000135502] [ENSMUST00000129954] [ENSMUST00000147171] [ENSMUST00000154906] [ENSMUST00000152674] [ENSMUST00000150374] [ENSMUST00000143875]
AlphaFold P42866
Predicted Effect probably damaging
Transcript: ENSMUST00000000783
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000783
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.3e-10 PFAM
Pfam:7tm_1 85 336 4e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052751
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056385
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060590
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063036
AA Change: S127P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766
AA Change: S127P

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078634
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077704
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 2.4e-10 PFAM
Pfam:7tm_1 85 336 9e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092729
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090405
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092731
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090407
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092734
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090410
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105597
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105602
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101227
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105603
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101228
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 6.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105604
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101229
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 5.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.8e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105605
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101230
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105607
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101232
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105611
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105615
AA Change: S127P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766
AA Change: S127P

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154941
AA Change: S131P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766
AA Change: S131P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129221
AA Change: S131P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766
AA Change: S131P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144264
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135502
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129954
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147171
AA Change: S127P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766
AA Change: S127P

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154906
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114342
Gene: ENSMUSG00000000766
AA Change: S195P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 1.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.1e-10 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect probably benign
Transcript: ENSMUST00000152674
SMART Domains Protein: ENSMUSP00000115552
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 94 8e-8 SMART
PDB:4DKL|A 52 94 7e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150374
Predicted Effect probably benign
Transcript: ENSMUST00000143875
Meta Mutation Damage Score 0.8668 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes the mu opioid receptor which is where drugs such as morphine and other opioids have pharmacological effects. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Oprm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Oprm1 APN 10 7037170 utr 3 prime probably benign
IGL01768:Oprm1 APN 10 6829186 missense probably damaging 1.00
IGL02455:Oprm1 APN 10 6830219 missense probably damaging 1.00
IGL03391:Oprm1 APN 10 7014077 intron probably benign
IGL03410:Oprm1 APN 10 6830051 missense probably damaging 1.00
IGL03048:Oprm1 UTSW 10 6829064 missense probably damaging 1.00
R0189:Oprm1 UTSW 10 6789071 missense possibly damaging 0.94
R0629:Oprm1 UTSW 10 6832604 splice site probably null
R0730:Oprm1 UTSW 10 6832652 intron probably benign
R1542:Oprm1 UTSW 10 6788960 missense probably damaging 1.00
R1743:Oprm1 UTSW 10 6830105 missense probably damaging 0.99
R1874:Oprm1 UTSW 10 6789035 missense probably benign 0.17
R2864:Oprm1 UTSW 10 6794226 splice site probably null
R2964:Oprm1 UTSW 10 6788914 missense probably damaging 0.98
R3792:Oprm1 UTSW 10 6839544 missense probably benign 0.00
R4008:Oprm1 UTSW 10 6832520 missense probably benign
R4049:Oprm1 UTSW 10 6829087 missense probably benign 0.36
R4088:Oprm1 UTSW 10 6830234 missense probably damaging 1.00
R4724:Oprm1 UTSW 10 6758656 nonsense probably null
R4812:Oprm1 UTSW 10 6832698 intron probably benign
R4822:Oprm1 UTSW 10 6829036 missense probably damaging 0.99
R4855:Oprm1 UTSW 10 6838468 missense probably benign 0.01
R5072:Oprm1 UTSW 10 6832550 missense probably benign 0.15
R5768:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5770:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5995:Oprm1 UTSW 10 6832520 missense probably benign
R6327:Oprm1 UTSW 10 6830063 missense probably damaging 0.99
R7135:Oprm1 UTSW 10 6830203 missense possibly damaging 0.77
R7413:Oprm1 UTSW 10 6828919 missense probably damaging 1.00
R7455:Oprm1 UTSW 10 6830204 missense probably damaging 1.00
R8192:Oprm1 UTSW 10 6838417 missense probably benign 0.04
R8210:Oprm1 UTSW 10 6830442 missense probably benign 0.02
R8945:Oprm1 UTSW 10 6832644 intron probably benign
R9054:Oprm1 UTSW 10 6823914 intron probably benign
R9723:Oprm1 UTSW 10 6838514 missense possibly damaging 0.66
R9726:Oprm1 UTSW 10 6979694 missense probably benign 0.00
X0066:Oprm1 UTSW 10 6830462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAACACCCCAGAATGCCATGTTTTC -3'
(R):5'- ACAGTTTGACAAAGATGCTGGACCG -3'

Sequencing Primer
(F):5'- GAAAAAGTCCTGGGTCTACTGTC -3'
(R):5'- ATGCTGGACCGTAAATTCTGC -3'
Posted On 2013-05-09