Incidental Mutation 'R4729:Vmn2r91'
ID358718
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
MMRRC Submission 041603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4729 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18107644 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 500 (I500K)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably damaging
Transcript: ENSMUST00000172359
AA Change: I500K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: I500K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,849,323 L220H unknown Het
Amt T A 9: 108,300,652 L272Q probably damaging Het
Ank2 G C 3: 126,976,896 Y894* probably null Het
Ankzf1 T A 1: 75,194,264 F105I probably damaging Het
Aox4 C A 1: 58,259,077 Y1067* probably null Het
BC034090 T A 1: 155,225,090 Q476L probably damaging Het
Bhmt G T 13: 93,627,363 R57S probably damaging Het
Cacna1c A T 6: 118,656,175 F964L probably damaging Het
Celsr3 A C 9: 108,847,652 S396R probably benign Het
Cpne4 C A 9: 104,922,556 Q191K probably damaging Het
Csnk1g2 T C 10: 80,639,204 Y352H probably benign Het
D630003M21Rik A G 2: 158,216,703 S426P probably damaging Het
Dido1 G T 2: 180,687,650 N326K probably benign Het
E2f2 T A 4: 136,184,449 I257N probably damaging Het
Elfn1 T G 5: 139,973,658 F806V probably damaging Het
Eml6 T A 11: 29,833,204 Y559F probably damaging Het
Erich6 A G 3: 58,636,059 probably null Het
Fam45a T A 19: 60,834,871 F315I probably benign Het
Fam78a T C 2: 32,082,605 N101S probably damaging Het
Fam83h A G 15: 76,002,336 S1051P probably benign Het
Galns C T 8: 122,603,456 G112D probably damaging Het
Gm7075 A T 10: 63,421,465 V92E probably damaging Het
Gm9923 A G 10: 72,309,694 K125R probably damaging Het
Hectd3 G A 4: 116,997,218 V326M probably damaging Het
Iars2 A G 1: 185,316,051 S495P possibly damaging Het
Ice1 T C 13: 70,606,384 R528G probably damaging Het
Igkv12-38 T A 6: 69,943,384 Y50F possibly damaging Het
Inpp5j T C 11: 3,495,025 S883G probably damaging Het
Irf8 T C 8: 120,753,439 S139P probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kcnq4 G T 4: 120,713,074 D357E possibly damaging Het
Klhl1 A G 14: 96,280,148 L364P probably damaging Het
Krt7 A G 15: 101,420,558 I309V probably benign Het
Krt76 G T 15: 101,889,081 A281D probably damaging Het
Lancl2 T C 6: 57,737,712 F430L probably damaging Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc26 A T 2: 25,290,064 T26S probably benign Het
Lrrk1 T A 7: 66,262,293 M1840L probably benign Het
Lyst G A 13: 13,637,901 C966Y probably damaging Het
Mad1l1 T A 5: 140,261,511 S354C possibly damaging Het
Mbtps1 C T 8: 119,525,420 G577D probably damaging Het
Mycbp2 C T 14: 103,188,591 R2366H probably damaging Het
Myo18a T G 11: 77,777,685 probably null Het
Naip5 G A 13: 100,222,131 R866C possibly damaging Het
Nav2 T A 7: 49,452,819 V455E probably benign Het
Neb A G 2: 52,263,662 I2417T possibly damaging Het
Nme5 C T 18: 34,569,837 A133T probably benign Het
Nradd T C 9: 110,621,911 D51G possibly damaging Het
Pard3b A G 1: 62,211,684 R591G probably damaging Het
Pcbp4 T C 9: 106,460,730 F73S probably damaging Het
Pcdhb11 C T 18: 37,422,366 Q250* probably null Het
Pde1c T A 6: 56,072,209 K766N probably damaging Het
Phf21b G A 15: 84,854,741 Q40* probably null Het
Prr14 A G 7: 127,474,696 D244G probably benign Het
Rab11fip5 C T 6: 85,374,267 A88T probably damaging Het
Rad54l2 A T 9: 106,716,118 S428T probably benign Het
Rdh9 A G 10: 127,776,752 I90V probably benign Het
Rhag G T 17: 40,828,401 G76C probably damaging Het
Riok3 T A 18: 12,128,927 V6E possibly damaging Het
Scn10a A G 9: 119,671,526 I229T probably damaging Het
Slco1a1 G T 6: 141,908,969 T652K probably benign Het
Slit1 T A 19: 41,647,020 I345F probably damaging Het
Snrnp200 A T 2: 127,232,937 I1477F probably damaging Het
Snx31 G A 15: 36,523,552 T328I possibly damaging Het
Strn A G 17: 78,657,961 F634S probably damaging Het
Tmem101 C T 11: 102,156,329 G6R probably benign Het
Tmem199 C G 11: 78,508,680 G131R probably benign Het
Trim66 A G 7: 109,456,060 probably null Het
Ttn G T 2: 76,851,585 probably benign Het
Upk3bl T C 5: 136,057,393 L61P probably benign Het
Vmn2r108 A G 17: 20,472,370 Y75H probably damaging Het
Vps18 C T 2: 119,293,791 R400C probably damaging Het
Zeb1 C T 18: 5,767,286 P599L probably damaging Het
Zfhx4 G T 3: 5,399,497 A1572S probably damaging Het
Zfp677 T A 17: 21,397,418 C246S possibly damaging Het
Zfp719 T A 7: 43,590,410 I474N probably damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 intron probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCTGAAGGACATTGAAGTGAG -3'
(R):5'- CGTAACAATTGGAGGAAACCTAATCC -3'

Sequencing Primer
(F):5'- TGAGAGACAAAAAGAGTTTAGGTTG -3'
(R):5'- CCTCATATAAGTTAGCAATGAGGGAC -3'
Posted On2015-11-11