Mutagenetix > Incidental Mutation

Incidental Mutation 'R4729:Zeb1'

358723

Institutional Source

Beutler Lab

Gene Symbol

Zeb1

Ensembl Gene

ENSMUSG00000024238

Gene Name

zinc finger E-box binding homeobox 1

Synonyms

3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1

MMRRC Submission

041603-MU

Accession Numbers

Genbank: NM_011546; MGI: 1344313

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R4729 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5591860-5775467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5767286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 599 (P599L)

Ref Sequence

ENSEMBL: ENSMUSP00000025081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025081] [ENSMUST00000159390] [ENSMUST00000175925]

AlphaFold

Q64318

Predicted Effect

probably damaging
Transcript: ENSMUST00000025081
AA Change: P599L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: P599L

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	150	173	3.16e-3	SMART
ZnF_C2H2	180	202	3.21e-4	SMART
ZnF_C2H2	220	242	4.87e-4	SMART
ZnF_C2H2	248	268	1.86e1	SMART
low complexity region	288	304	N/A	INTRINSIC
low complexity region	532	555	N/A	INTRINSIC
HOX	559	621	7.53e-3	SMART
low complexity region	730	742	N/A	INTRINSIC
low complexity region	766	783	N/A	INTRINSIC
ZnF_C2H2	882	904	1.18e-2	SMART
ZnF_C2H2	910	932	4.4e-2	SMART
ZnF_C2H2	938	959	1.89e-1	SMART
coiled coil region	1006	1077	N/A	INTRINSIC
low complexity region	1096	1112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159390

SMART Domains

Protein: ENSMUSP00000124395
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	96	119	3.16e-3	SMART
ZnF_C2H2	126	148	3.21e-4	SMART
ZnF_C2H2	166	188	4.87e-4	SMART
ZnF_C2H2	194	214	1.86e1	SMART
low complexity region	234	250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162892

SMART Domains

Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	94	117	1.3e-5	SMART
ZnF_C2H2	124	146	1.3e-6	SMART
ZnF_C2H2	164	186	2e-6	SMART
ZnF_C2H2	192	212	7.8e-2	SMART
low complexity region	232	248	N/A	INTRINSIC
low complexity region	476	499	N/A	INTRINSIC
HOX	503	565	3.9e-5	SMART
low complexity region	674	686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175925

SMART Domains

Protein: ENSMUSP00000135125
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	130	153	3.16e-3	SMART
ZnF_C2H2	160	182	3.21e-4	SMART
ZnF_C2H2	200	222	4.87e-4	SMART
ZnF_C2H2	228	248	1.86e1	SMART
low complexity region	268	284	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177030

SMART Domains

Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	22	44	4.87e-4	SMART
low complexity region	277	300	N/A	INTRINSIC
HOX	304	366	7.53e-3	SMART
low complexity region	475	487	N/A	INTRINSIC
low complexity region	511	528	N/A	INTRINSIC
ZnF_C2H2	627	649	1.18e-2	SMART
ZnF_C2H2	655	677	4.4e-2	SMART
ZnF_C2H2	683	704	1.89e-1	SMART
low complexity region	758	775	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,849,323	L220H	unknown	Het
Amt	T	A	9: 108,300,652	L272Q	probably damaging	Het
Ank2	G	C	3: 126,976,896	Y894*	probably null	Het
Ankzf1	T	A	1: 75,194,264	F105I	probably damaging	Het
Aox4	C	A	1: 58,259,077	Y1067*	probably null	Het
BC034090	T	A	1: 155,225,090	Q476L	probably damaging	Het
Bhmt	G	T	13: 93,627,363	R57S	probably damaging	Het
Cacna1c	A	T	6: 118,656,175	F964L	probably damaging	Het
Celsr3	A	C	9: 108,847,652	S396R	probably benign	Het
Cpne4	C	A	9: 104,922,556	Q191K	probably damaging	Het
Csnk1g2	T	C	10: 80,639,204	Y352H	probably benign	Het
D630003M21Rik	A	G	2: 158,216,703	S426P	probably damaging	Het
Dido1	G	T	2: 180,687,650	N326K	probably benign	Het
E2f2	T	A	4: 136,184,449	I257N	probably damaging	Het
Elfn1	T	G	5: 139,973,658	F806V	probably damaging	Het
Eml6	T	A	11: 29,833,204	Y559F	probably damaging	Het
Erich6	A	G	3: 58,636,059		probably null	Het
Fam45a	T	A	19: 60,834,871	F315I	probably benign	Het
Fam78a	T	C	2: 32,082,605	N101S	probably damaging	Het
Fam83h	A	G	15: 76,002,336	S1051P	probably benign	Het
Galns	C	T	8: 122,603,456	G112D	probably damaging	Het
Gm7075	A	T	10: 63,421,465	V92E	probably damaging	Het
Gm9923	A	G	10: 72,309,694	K125R	probably damaging	Het
Hectd3	G	A	4: 116,997,218	V326M	probably damaging	Het
Iars2	A	G	1: 185,316,051	S495P	possibly damaging	Het
Ice1	T	C	13: 70,606,384	R528G	probably damaging	Het
Igkv12-38	T	A	6: 69,943,384	Y50F	possibly damaging	Het
Inpp5j	T	C	11: 3,495,025	S883G	probably damaging	Het
Irf8	T	C	8: 120,753,439	S139P	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Kcnq4	G	T	4: 120,713,074	D357E	possibly damaging	Het
Klhl1	A	G	14: 96,280,148	L364P	probably damaging	Het
Krt7	A	G	15: 101,420,558	I309V	probably benign	Het
Krt76	G	T	15: 101,889,081	A281D	probably damaging	Het
Lancl2	T	C	6: 57,737,712	F430L	probably damaging	Het
Llgl2	T	C	11: 115,848,299	V332A	probably damaging	Het
Lrrc26	A	T	2: 25,290,064	T26S	probably benign	Het
Lrrk1	T	A	7: 66,262,293	M1840L	probably benign	Het
Lyst	G	A	13: 13,637,901	C966Y	probably damaging	Het
Mad1l1	T	A	5: 140,261,511	S354C	possibly damaging	Het
Mbtps1	C	T	8: 119,525,420	G577D	probably damaging	Het
Mycbp2	C	T	14: 103,188,591	R2366H	probably damaging	Het
Myo18a	T	G	11: 77,777,685		probably null	Het
Naip5	G	A	13: 100,222,131	R866C	possibly damaging	Het
Nav2	T	A	7: 49,452,819	V455E	probably benign	Het
Neb	A	G	2: 52,263,662	I2417T	possibly damaging	Het
Nme5	C	T	18: 34,569,837	A133T	probably benign	Het
Nradd	T	C	9: 110,621,911	D51G	possibly damaging	Het
Pard3b	A	G	1: 62,211,684	R591G	probably damaging	Het
Pcbp4	T	C	9: 106,460,730	F73S	probably damaging	Het
Pcdhb11	C	T	18: 37,422,366	Q250*	probably null	Het
Pde1c	T	A	6: 56,072,209	K766N	probably damaging	Het
Phf21b	G	A	15: 84,854,741	Q40*	probably null	Het
Prr14	A	G	7: 127,474,696	D244G	probably benign	Het
Rab11fip5	C	T	6: 85,374,267	A88T	probably damaging	Het
Rad54l2	A	T	9: 106,716,118	S428T	probably benign	Het
Rdh9	A	G	10: 127,776,752	I90V	probably benign	Het
Rhag	G	T	17: 40,828,401	G76C	probably damaging	Het
Riok3	T	A	18: 12,128,927	V6E	possibly damaging	Het
Scn10a	A	G	9: 119,671,526	I229T	probably damaging	Het
Slco1a1	G	T	6: 141,908,969	T652K	probably benign	Het
Slit1	T	A	19: 41,647,020	I345F	probably damaging	Het
Snrnp200	A	T	2: 127,232,937	I1477F	probably damaging	Het
Snx31	G	A	15: 36,523,552	T328I	possibly damaging	Het
Strn	A	G	17: 78,657,961	F634S	probably damaging	Het
Tmem101	C	T	11: 102,156,329	G6R	probably benign	Het
Tmem199	C	G	11: 78,508,680	G131R	probably benign	Het
Trim66	A	G	7: 109,456,060		probably null	Het
Ttn	G	T	2: 76,851,585		probably benign	Het
Upk3bl	T	C	5: 136,057,393	L61P	probably benign	Het
Vmn2r108	A	G	17: 20,472,370	Y75H	probably damaging	Het
Vmn2r91	T	A	17: 18,107,644	I500K	probably damaging	Het
Vps18	C	T	2: 119,293,791	R400C	probably damaging	Het
Zfhx4	G	T	3: 5,399,497	A1572S	probably damaging	Het
Zfp677	T	A	17: 21,397,418	C246S	possibly damaging	Het
Zfp719	T	A	7: 43,590,410	I474N	probably damaging	Het

Other mutations in Zeb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Zeb1	APN	18	5767774	missense	probably benign	0.00
IGL01139:Zeb1	APN	18	5705061	missense	possibly damaging	0.69
IGL01444:Zeb1	APN	18	5767906	missense	probably damaging	1.00
IGL01444:Zeb1	APN	18	5767138	missense	probably benign
IGL01806:Zeb1	APN	18	5767867	missense	possibly damaging	0.94
IGL01988:Zeb1	APN	18	5759037	nonsense	probably null
IGL02059:Zeb1	APN	18	5766892	missense	probably damaging	1.00
IGL03005:Zeb1	APN	18	5767150	missense	probably benign	0.03
IGL03153:Zeb1	APN	18	5770511	missense	probably damaging	1.00
Apes	UTSW	18	5761394	missense	probably damaging	1.00
cellophane	UTSW	18	5770554	nonsense	probably null
serpens	UTSW	18	5772455	missense	probably damaging	1.00
N/A - 293:Zeb1	UTSW	18	5767076	missense	possibly damaging	0.68
R0184:Zeb1	UTSW	18	5766808	missense	probably damaging	1.00
R0488:Zeb1	UTSW	18	5772455	missense	probably damaging	1.00
R0622:Zeb1	UTSW	18	5759123	nonsense	probably null
R0646:Zeb1	UTSW	18	5759027	missense	probably damaging	1.00
R0881:Zeb1	UTSW	18	5767138	missense	probably benign
R1251:Zeb1	UTSW	18	5705089	missense	probably damaging	1.00
R1257:Zeb1	UTSW	18	5772699	missense	possibly damaging	0.53
R1501:Zeb1	UTSW	18	5761399	missense	possibly damaging	0.95
R1547:Zeb1	UTSW	18	5767450	missense	possibly damaging	0.50
R1797:Zeb1	UTSW	18	5766298	nonsense	probably null
R1815:Zeb1	UTSW	18	5767898	missense	probably damaging	1.00
R2090:Zeb1	UTSW	18	5766458	missense	possibly damaging	0.65
R2129:Zeb1	UTSW	18	5767681	missense	possibly damaging	0.92
R2875:Zeb1	UTSW	18	5772859	small insertion	probably benign
R3888:Zeb1	UTSW	18	5748743	missense	probably damaging	1.00
R3941:Zeb1	UTSW	18	5767799	missense	probably benign	0.06
R3952:Zeb1	UTSW	18	5772716	missense	probably benign	0.17
R4271:Zeb1	UTSW	18	5758985	missense	probably damaging	0.99
R4512:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4514:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4677:Zeb1	UTSW	18	5766775	missense	probably damaging	0.97
R5839:Zeb1	UTSW	18	5767507	missense	probably benign
R5913:Zeb1	UTSW	18	5766765	missense	possibly damaging	0.49
R6248:Zeb1	UTSW	18	5766962	missense	probably damaging	1.00
R6354:Zeb1	UTSW	18	5772743	missense	possibly damaging	0.64
R6429:Zeb1	UTSW	18	5770498	missense	probably damaging	1.00
R6819:Zeb1	UTSW	18	5591917	missense	probably damaging	1.00
R7180:Zeb1	UTSW	18	5767867	missense	possibly damaging	0.94
R7193:Zeb1	UTSW	18	5772756	missense	probably damaging	0.98
R7199:Zeb1	UTSW	18	5767703	missense	probably benign	0.00
R7397:Zeb1	UTSW	18	5761394	missense	probably damaging	1.00
R7534:Zeb1	UTSW	18	5766611	missense	probably damaging	1.00
R7702:Zeb1	UTSW	18	5766802	missense	probably damaging	1.00
R7703:Zeb1	UTSW	18	5766917	missense	probably benign
R7934:Zeb1	UTSW	18	5748703	missense	probably benign	0.00
R8504:Zeb1	UTSW	18	5705127	missense	possibly damaging	0.94
R8539:Zeb1	UTSW	18	5748784	missense	probably damaging	0.99
R8716:Zeb1	UTSW	18	5767958	missense	probably damaging	0.99
R8772:Zeb1	UTSW	18	5770382	critical splice acceptor site	probably null
R8824:Zeb1	UTSW	18	5748680	splice site	probably benign
R9082:Zeb1	UTSW	18	5772557	missense	probably damaging	0.98
R9085:Zeb1	UTSW	18	5766716	missense	probably damaging	1.00
R9274:Zeb1	UTSW	18	5772840	small deletion	probably benign
R9456:Zeb1	UTSW	18	5766709	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGACCTCAATGCACTTCCAG -3'
(R):5'- AGAGCTCCTTATCTTGACAGGAC -3'

Sequencing Primer
(F):5'- ACTATGACCCAGAGTGCCCTG -3'
(R):5'- ACTCTGTCCGCGTGTGCTG -3'

Posted On

2015-11-11