Incidental Mutation 'R4729:Zeb1'
ID 358723
Institutional Source Beutler Lab
Gene Symbol Zeb1
Ensembl Gene ENSMUSG00000024238
Gene Name zinc finger E-box binding homeobox 1
Synonyms Nil2, Tcf18, 3110032K11Rik, Zfhep, ZEB, AREB6, Tcf8, Zfhx1a, MEB1, Tw, [delta]EF1, Zfx1a
MMRRC Submission 041603-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R4729 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 5591860-5775467 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5767286 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 599 (P599L)
Ref Sequence ENSEMBL: ENSMUSP00000025081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025081] [ENSMUST00000159390] [ENSMUST00000175925]
AlphaFold Q64318
Predicted Effect probably damaging
Transcript: ENSMUST00000025081
AA Change: P599L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: P599L

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159390
SMART Domains Protein: ENSMUSP00000124395
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 96 119 3.16e-3 SMART
ZnF_C2H2 126 148 3.21e-4 SMART
ZnF_C2H2 166 188 4.87e-4 SMART
ZnF_C2H2 194 214 1.86e1 SMART
low complexity region 234 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162892
SMART Domains Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 94 117 1.3e-5 SMART
ZnF_C2H2 124 146 1.3e-6 SMART
ZnF_C2H2 164 186 2e-6 SMART
ZnF_C2H2 192 212 7.8e-2 SMART
low complexity region 232 248 N/A INTRINSIC
low complexity region 476 499 N/A INTRINSIC
HOX 503 565 3.9e-5 SMART
low complexity region 674 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175925
SMART Domains Protein: ENSMUSP00000135125
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 130 153 3.16e-3 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 200 222 4.87e-4 SMART
ZnF_C2H2 228 248 1.86e1 SMART
low complexity region 268 284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177030
SMART Domains Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 22 44 4.87e-4 SMART
low complexity region 277 300 N/A INTRINSIC
HOX 304 366 7.53e-3 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
ZnF_C2H2 627 649 1.18e-2 SMART
ZnF_C2H2 655 677 4.4e-2 SMART
ZnF_C2H2 683 704 1.89e-1 SMART
low complexity region 758 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,667,187 (GRCm39) L220H unknown Het
Amt T A 9: 108,177,851 (GRCm39) L272Q probably damaging Het
Ank2 G C 3: 126,770,545 (GRCm39) Y894* probably null Het
Ankzf1 T A 1: 75,170,908 (GRCm39) F105I probably damaging Het
Aox4 C A 1: 58,298,236 (GRCm39) Y1067* probably null Het
BC034090 T A 1: 155,100,836 (GRCm39) Q476L probably damaging Het
Bhmt G T 13: 93,763,871 (GRCm39) R57S probably damaging Het
Cacna1c A T 6: 118,633,136 (GRCm39) F964L probably damaging Het
Celsr3 A C 9: 108,724,851 (GRCm39) S396R probably benign Het
Cpne4 C A 9: 104,799,755 (GRCm39) Q191K probably damaging Het
Csnk1g2 T C 10: 80,475,038 (GRCm39) Y352H probably benign Het
D630003M21Rik A G 2: 158,058,623 (GRCm39) S426P probably damaging Het
Dennd10 T A 19: 60,823,309 (GRCm39) F315I probably benign Het
Dido1 G T 2: 180,329,443 (GRCm39) N326K probably benign Het
E2f2 T A 4: 135,911,760 (GRCm39) I257N probably damaging Het
Elfn1 T G 5: 139,959,413 (GRCm39) F806V probably damaging Het
Eml6 T A 11: 29,783,204 (GRCm39) Y559F probably damaging Het
Erich6 A G 3: 58,543,480 (GRCm39) probably null Het
Fam78a T C 2: 31,972,617 (GRCm39) N101S probably damaging Het
Fam83h A G 15: 75,874,185 (GRCm39) S1051P probably benign Het
Galns C T 8: 123,330,195 (GRCm39) G112D probably damaging Het
Gm9923 A G 10: 72,145,524 (GRCm39) K125R probably damaging Het
Hectd3 G A 4: 116,854,415 (GRCm39) V326M probably damaging Het
Iars2 A G 1: 185,048,248 (GRCm39) S495P possibly damaging Het
Ice1 T C 13: 70,754,503 (GRCm39) R528G probably damaging Het
Igkv12-38 T A 6: 69,920,368 (GRCm39) Y50F possibly damaging Het
Inpp5j T C 11: 3,445,025 (GRCm39) S883G probably damaging Het
Irf8 T C 8: 121,480,178 (GRCm39) S139P probably damaging Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Kcnq4 G T 4: 120,570,271 (GRCm39) D357E possibly damaging Het
Klhl1 A G 14: 96,517,584 (GRCm39) L364P probably damaging Het
Krt7 A G 15: 101,318,439 (GRCm39) I309V probably benign Het
Krt76 G T 15: 101,797,516 (GRCm39) A281D probably damaging Het
Lancl2 T C 6: 57,714,697 (GRCm39) F430L probably damaging Het
Llgl2 T C 11: 115,739,125 (GRCm39) V332A probably damaging Het
Lrrc26 A T 2: 25,180,076 (GRCm39) T26S probably benign Het
Lrrk1 T A 7: 65,912,041 (GRCm39) M1840L probably benign Het
Lyst G A 13: 13,812,486 (GRCm39) C966Y probably damaging Het
Mad1l1 T A 5: 140,247,266 (GRCm39) S354C possibly damaging Het
Mbtps1 C T 8: 120,252,159 (GRCm39) G577D probably damaging Het
Mycbp2 C T 14: 103,426,027 (GRCm39) R2366H probably damaging Het
Myo18a T G 11: 77,668,511 (GRCm39) probably null Het
Naip5 G A 13: 100,358,639 (GRCm39) R866C possibly damaging Het
Nav2 T A 7: 49,102,567 (GRCm39) V455E probably benign Het
Neb A G 2: 52,153,674 (GRCm39) I2417T possibly damaging Het
Nme5 C T 18: 34,702,890 (GRCm39) A133T probably benign Het
Nradd T C 9: 110,450,979 (GRCm39) D51G possibly damaging Het
Pard3b A G 1: 62,250,843 (GRCm39) R591G probably damaging Het
Pcbp4 T C 9: 106,337,929 (GRCm39) F73S probably damaging Het
Pcdhb11 C T 18: 37,555,419 (GRCm39) Q250* probably null Het
Pde1c T A 6: 56,049,194 (GRCm39) K766N probably damaging Het
Phf21b G A 15: 84,738,942 (GRCm39) Q40* probably null Het
Prr14 A G 7: 127,073,868 (GRCm39) D244G probably benign Het
Rab11fip5 C T 6: 85,351,249 (GRCm39) A88T probably damaging Het
Rad54l2 A T 9: 106,593,317 (GRCm39) S428T probably benign Het
Rdh9 A G 10: 127,612,621 (GRCm39) I90V probably benign Het
Rhag G T 17: 41,139,292 (GRCm39) G76C probably damaging Het
Riok3 T A 18: 12,261,984 (GRCm39) V6E possibly damaging Het
Rnf7l A T 10: 63,257,244 (GRCm39) V92E probably damaging Het
Scn10a A G 9: 119,500,592 (GRCm39) I229T probably damaging Het
Slco1a1 G T 6: 141,854,695 (GRCm39) T652K probably benign Het
Slit1 T A 19: 41,635,459 (GRCm39) I345F probably damaging Het
Snrnp200 A T 2: 127,074,857 (GRCm39) I1477F probably damaging Het
Snx31 G A 15: 36,523,698 (GRCm39) T328I possibly damaging Het
Strn A G 17: 78,965,390 (GRCm39) F634S probably damaging Het
Tmem101 C T 11: 102,047,155 (GRCm39) G6R probably benign Het
Tmem199 C G 11: 78,399,506 (GRCm39) G131R probably benign Het
Trim66 A G 7: 109,055,267 (GRCm39) probably null Het
Ttn G T 2: 76,681,929 (GRCm39) probably benign Het
Upk3bl T C 5: 136,086,247 (GRCm39) L61P probably benign Het
Vmn2r108 A G 17: 20,692,632 (GRCm39) Y75H probably damaging Het
Vmn2r91 T A 17: 18,327,906 (GRCm39) I500K probably damaging Het
Vps18 C T 2: 119,124,272 (GRCm39) R400C probably damaging Het
Zfhx4 G T 3: 5,464,557 (GRCm39) A1572S probably damaging Het
Zfp677 T A 17: 21,617,680 (GRCm39) C246S possibly damaging Het
Zfp719 T A 7: 43,239,834 (GRCm39) I474N probably damaging Het
Other mutations in Zeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5,767,774 (GRCm39) missense probably benign 0.00
IGL01139:Zeb1 APN 18 5,705,061 (GRCm39) missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5,767,138 (GRCm39) missense probably benign
IGL01444:Zeb1 APN 18 5,767,906 (GRCm39) missense probably damaging 1.00
IGL01806:Zeb1 APN 18 5,767,867 (GRCm39) missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5,759,037 (GRCm39) nonsense probably null
IGL02059:Zeb1 APN 18 5,766,892 (GRCm39) missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5,767,150 (GRCm39) missense probably benign 0.03
IGL03153:Zeb1 APN 18 5,770,511 (GRCm39) missense probably damaging 1.00
Apes UTSW 18 5,761,394 (GRCm39) missense probably damaging 1.00
cellophane UTSW 18 5,770,554 (GRCm39) nonsense probably null
serpens UTSW 18 5,772,455 (GRCm39) missense probably damaging 1.00
N/A - 293:Zeb1 UTSW 18 5,767,076 (GRCm39) missense possibly damaging 0.68
R0184:Zeb1 UTSW 18 5,766,808 (GRCm39) missense probably damaging 1.00
R0488:Zeb1 UTSW 18 5,772,455 (GRCm39) missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5,759,123 (GRCm39) nonsense probably null
R0646:Zeb1 UTSW 18 5,759,027 (GRCm39) missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5,767,138 (GRCm39) missense probably benign
R1251:Zeb1 UTSW 18 5,705,089 (GRCm39) missense probably damaging 1.00
R1257:Zeb1 UTSW 18 5,772,699 (GRCm39) missense possibly damaging 0.53
R1501:Zeb1 UTSW 18 5,761,399 (GRCm39) missense possibly damaging 0.95
R1547:Zeb1 UTSW 18 5,767,450 (GRCm39) missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5,766,298 (GRCm39) nonsense probably null
R1815:Zeb1 UTSW 18 5,767,898 (GRCm39) missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5,766,458 (GRCm39) missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5,767,681 (GRCm39) missense possibly damaging 0.92
R2875:Zeb1 UTSW 18 5,772,859 (GRCm39) small insertion probably benign
R3888:Zeb1 UTSW 18 5,748,743 (GRCm39) missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5,767,799 (GRCm39) missense probably benign 0.06
R3952:Zeb1 UTSW 18 5,772,716 (GRCm39) missense probably benign 0.17
R4271:Zeb1 UTSW 18 5,758,985 (GRCm39) missense probably damaging 0.99
R4512:Zeb1 UTSW 18 5,759,007 (GRCm39) missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5,759,007 (GRCm39) missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5,766,775 (GRCm39) missense probably damaging 0.97
R5839:Zeb1 UTSW 18 5,767,507 (GRCm39) missense probably benign
R5913:Zeb1 UTSW 18 5,766,765 (GRCm39) missense possibly damaging 0.49
R6248:Zeb1 UTSW 18 5,766,962 (GRCm39) missense probably damaging 1.00
R6354:Zeb1 UTSW 18 5,772,743 (GRCm39) missense possibly damaging 0.64
R6429:Zeb1 UTSW 18 5,770,498 (GRCm39) missense probably damaging 1.00
R6819:Zeb1 UTSW 18 5,591,917 (GRCm39) missense probably damaging 1.00
R7180:Zeb1 UTSW 18 5,767,867 (GRCm39) missense possibly damaging 0.94
R7193:Zeb1 UTSW 18 5,772,756 (GRCm39) missense probably damaging 0.98
R7199:Zeb1 UTSW 18 5,767,703 (GRCm39) missense probably benign 0.00
R7397:Zeb1 UTSW 18 5,761,394 (GRCm39) missense probably damaging 1.00
R7534:Zeb1 UTSW 18 5,766,611 (GRCm39) missense probably damaging 1.00
R7702:Zeb1 UTSW 18 5,766,802 (GRCm39) missense probably damaging 1.00
R7703:Zeb1 UTSW 18 5,766,917 (GRCm39) missense probably benign
R7934:Zeb1 UTSW 18 5,748,703 (GRCm39) missense probably benign 0.00
R8504:Zeb1 UTSW 18 5,705,127 (GRCm39) missense possibly damaging 0.94
R8539:Zeb1 UTSW 18 5,748,784 (GRCm39) missense probably damaging 0.99
R8716:Zeb1 UTSW 18 5,767,958 (GRCm39) missense probably damaging 0.99
R8772:Zeb1 UTSW 18 5,770,382 (GRCm39) critical splice acceptor site probably null
R8824:Zeb1 UTSW 18 5,748,680 (GRCm39) splice site probably benign
R9082:Zeb1 UTSW 18 5,772,557 (GRCm39) missense probably damaging 0.98
R9085:Zeb1 UTSW 18 5,766,716 (GRCm39) missense probably damaging 1.00
R9456:Zeb1 UTSW 18 5,766,709 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACCTCAATGCACTTCCAG -3'
(R):5'- AGAGCTCCTTATCTTGACAGGAC -3'

Sequencing Primer
(F):5'- ACTATGACCCAGAGTGCCCTG -3'
(R):5'- ACTCTGTCCGCGTGTGCTG -3'
Posted On 2015-11-11