Incidental Mutation 'R0321:Ap1b1'
ID35873
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Nameadaptor protein complex AP-1, beta 1 subunit
SynonymsAdtb1, beta-prime adaptin
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R0321 (G1)
Quality Score110
Status Validated
Chromosome11
Chromosomal Location4986824-5042791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5032464 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 588 (A588T)
Ref Sequence ENSEMBL: ENSMUSP00000105523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
Predicted Effect probably benign
Transcript: ENSMUST00000009234
AA Change: A615T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: A615T

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101613
AA Change: A588T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: A588T

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109897
AA Change: A588T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: A588T

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145704
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 5019433 missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 5039169 missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 5019336 missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 5024452 nonsense probably null
IGL02318:Ap1b1 APN 11 5019294 missense probably benign 0.14
IGL02505:Ap1b1 APN 11 5031700 missense probably benign 0.11
IGL02824:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 5040360 missense probably damaging 1.00
R0477:Ap1b1 UTSW 11 5031787 missense probably benign 0.13
R0622:Ap1b1 UTSW 11 5037707 missense probably damaging 0.96
R0831:Ap1b1 UTSW 11 5023092 splice site probably benign
R1502:Ap1b1 UTSW 11 5040290 missense probably benign
R1529:Ap1b1 UTSW 11 5039547 missense probably damaging 1.00
R2110:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 5015737 missense possibly damaging 0.84
R2906:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2907:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 5023135 missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 5024427 missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 5033225 splice site probably null
R4207:Ap1b1 UTSW 11 5031637 missense probably damaging 0.96
R4660:Ap1b1 UTSW 11 5016760 missense probably damaging 1.00
R4710:Ap1b1 UTSW 11 5031664 missense probably damaging 0.97
R4826:Ap1b1 UTSW 11 5018043 missense probably benign 0.11
R4914:Ap1b1 UTSW 11 5024400 missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 5018020 missense possibly damaging 0.83
R5249:Ap1b1 UTSW 11 5026364 missense probably damaging 0.97
R6014:Ap1b1 UTSW 11 5019364 missense possibly damaging 0.55
R6268:Ap1b1 UTSW 11 5019493 missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 5026319 missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 5019427 missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 5012972 missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 5030963 missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 5039558 missense probably benign 0.02
R8291:Ap1b1 UTSW 11 5018027 missense probably damaging 1.00
X0018:Ap1b1 UTSW 11 5009581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATATAGTCCTGTGCCCACACC -3'
(R):5'- CAGTAAGCATTTCACGTACCCTCCC -3'

Sequencing Primer
(F):5'- AGACCCAGGCAAAGATCTTG -3'
(R):5'- AAAGCCTGCTGCTCTGAAG -3'
Posted On2013-05-09