Mutagenetix > Incidental Mutations

Incidental Mutation 'R4730:Lin9'

358731

Institutional Source

Beutler Lab

Gene Symbol

Lin9

Ensembl Gene

ENSMUSG00000058729

Gene Name

lin-9 homolog (C. elegans)

Synonyms

2700022J23Rik

MMRRC Submission

041990-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4730 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180641150-180690694 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 180665851 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 198 (L198*)

Ref Sequence

ENSEMBL: ENSMUSP00000141530 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]

Predicted Effect

probably null
Transcript: ENSMUST00000085803
AA Change: L198*

SMART Domains

Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: L198*

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000085804

SMART Domains

Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC
transmembrane domain	416	438	N/A	INTRINSIC
low complexity region	445	458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191744

Predicted Effect

probably null
Transcript: ENSMUST00000192561
AA Change: L214*

SMART Domains

Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: L214*

Domain	Start	End	E-Value	Type
DIRP	143	248	2.2e-71	SMART
coiled coil region	370	428	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000192725
AA Change: L174*

SMART Domains

Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: L174*

Domain	Start	End	E-Value	Type
DIRP	103	208	2.2e-71	SMART
coiled coil region	330	388	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000193892
AA Change: L198*

SMART Domains

Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729
AA Change: L198*

Domain	Start	End	E-Value	Type
DIRP	127	232	2.2e-71	SMART

Predicted Effect

silent
Transcript: ENSMUST00000194638

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff1	A	G	5: 103,843,073	Q963R	possibly damaging	Het
Arhgef28	C	T	13: 97,978,142	E645K	probably benign	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Col4a2	A	G	8: 11,437,590	N964S	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Duox1	T	G	2: 122,333,831	L924R	probably damaging	Het
Edem2	T	C	2: 155,705,698	E398G	possibly damaging	Het
Engase	A	G	11: 118,482,922	N297D	probably damaging	Het
Esp4	A	C	17: 40,602,554	Y104S	unknown	Het
Esp4	C	A	17: 40,602,555	Y104*	probably null	Het
Fat1	A	T	8: 45,033,477	N3356I	probably damaging	Het
Gm3867	T	A	9: 36,257,254		noncoding transcript	Het
Gm6818	C	T	7: 38,402,494		noncoding transcript	Het
Grip2	T	C	6: 91,785,712	*175W	probably null	Het
Gucy1b2	A	G	14: 62,407,759	V617A	probably damaging	Het
Gzmc	C	T	14: 56,231,632	C210Y	probably damaging	Het
Hmg20a	T	A	9: 56,467,419	S20T	possibly damaging	Het
Hs3st1	A	T	5: 39,614,805	L165*	probably null	Het
Ighv1-26	A	G	12: 114,788,789	I6T	probably benign	Het
Kcnk13	A	G	12: 100,061,715	K350E	probably damaging	Het
Lrfn5	C	T	12: 61,840,719	A431V	probably benign	Het
Lta	C	T	17: 35,204,089	R86Q	probably benign	Het
Map3k4	T	A	17: 12,248,974	I1058L	probably damaging	Het
Mtif2	T	A	11: 29,540,834	S513T	probably benign	Het
Muc4	C	T	16: 32,751,214	T364I	possibly damaging	Het
Nav1	C	A	1: 135,607,311		probably benign	Het
Nfrkb	T	C	9: 31,410,251	V748A	probably benign	Het
Obox6	A	T	7: 15,834,813	M46K	possibly damaging	Het
Olfr1002	T	C	2: 85,647,992	T110A	probably benign	Het
Olfr1013	G	T	2: 85,770,061	E87*	probably null	Het
Olfr1102	C	T	2: 87,002,166	R66W	possibly damaging	Het
Olfr172	T	C	16: 58,760,742	I145V	probably benign	Het
Olfr820	G	A	10: 130,017,547	R62Q	probably damaging	Het
P4htm	A	G	9: 108,579,772	V412A	possibly damaging	Het
Phb2	T	C	6: 124,713,123	S92P	probably damaging	Het
Phtf1	G	T	3: 103,987,435	R147L	probably damaging	Het
Pigk	C	T	3: 152,742,566	Q189*	probably null	Het
Plxnc1	G	A	10: 94,867,468		probably benign	Het
Prrx1	A	G	1: 163,312,613	V8A	probably benign	Het
Ptprg	G	A	14: 12,213,713	G252D	probably damaging	Het
Rnf4	G	T	5: 34,350,803	V134F	possibly damaging	Het
Scarf2	A	G	16: 17,803,013	T182A	probably damaging	Het
Setd1a	A	G	7: 127,797,330		probably benign	Het
Sgpp1	A	G	12: 75,734,939	F209L	probably benign	Het
Sh3d19	T	A	3: 86,116,864	S567T	possibly damaging	Het
Slc4a2	C	T	5: 24,434,880	R520W	probably damaging	Het
Slf1	T	C	13: 77,046,632	Q858R	probably damaging	Het
Slitrk3	G	T	3: 73,049,519	A640E	probably benign	Het
Smarca2	A	G	19: 26,630,673	Y44C	probably damaging	Het
Spon1	A	G	7: 114,033,071	E543G	possibly damaging	Het
Strn4	A	G	7: 16,828,794	Q286R	possibly damaging	Het
Suz12	T	C	11: 80,002,162		probably benign	Het
Syna	T	A	5: 134,558,586	E503V	probably damaging	Het
Syt14	C	T	1: 192,930,786	D569N	probably damaging	Het
Sytl2	A	G	7: 90,381,249		probably benign	Het
Tmprss11g	G	T	5: 86,489,232	S335*	probably null	Het
Tmprss11g	A	T	5: 86,489,233	S335T	probably damaging	Het
Trim66	A	G	7: 109,483,069	S226P	probably damaging	Het
Tubgcp3	T	C	8: 12,657,654	T112A	probably benign	Het
Ulk4	T	C	9: 121,263,725	S149G	probably benign	Het
Usp53	T	C	3: 122,962,933	D108G	probably null	Het
Vmn1r91	A	T	7: 20,101,770	T205S	possibly damaging	Het

Other mutations in Lin9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Lin9	APN	1	180667367	missense	probably damaging	1.00
IGL02221:Lin9	APN	1	180650834	missense	probably benign	0.03
IGL02233:Lin9	APN	1	180689300	missense	probably damaging	0.98
IGL02370:Lin9	APN	1	180688018	missense	probably damaging	1.00
IGL02794:Lin9	APN	1	180651879	missense	probably damaging	1.00
R0278:Lin9	UTSW	1	180665923	missense	probably damaging	1.00
R1488:Lin9	UTSW	1	180688285	missense	possibly damaging	0.61
R3808:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3809:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3884:Lin9	UTSW	1	180688065	nonsense	probably null
R3978:Lin9	UTSW	1	180668792	missense	possibly damaging	0.94
R4600:Lin9	UTSW	1	180681194	missense	probably damaging	0.99
R4625:Lin9	UTSW	1	180689280	missense	probably damaging	0.99
R4987:Lin9	UTSW	1	180668764	missense	probably damaging	1.00
R5034:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5035:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5045:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5046:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5148:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5180:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5181:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5221:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5222:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5329:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5332:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5633:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5634:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5696:Lin9	UTSW	1	180659081	missense	probably benign	0.00
R5812:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5813:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5814:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5851:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R7046:Lin9	UTSW	1	180667370	missense	probably damaging	1.00
R7084:Lin9	UTSW	1	180688096	missense	probably benign	0.11
R8163:Lin9	UTSW	1	180659126	missense	probably damaging	1.00
R8421:Lin9	UTSW	1	180665800	missense	probably damaging	1.00
Z1177:Lin9	UTSW	1	180650802	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GACCCCTCAAATGTATCTGATCGT -3'
(R):5'- ATATTTCTTCCCTCTAGCGACTG -3'

Sequencing Primer
(F):5'- CGTACACTTCCAACATAATTTGCTG -3'
(R):5'- GCGACTGCTGCAGAGGC -3'

Posted On

2015-11-11