Incidental Mutation 'R4730:Slitrk3'
ID358738
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73049519 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 640 (A640E)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably benign
Transcript: ENSMUST00000059407
AA Change: A640E

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: A640E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000192477
AA Change: A640E

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: A640E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
R7577:Slitrk3 UTSW 3 73051115 missense probably damaging 0.99
R7757:Slitrk3 UTSW 3 73050839 missense probably damaging 1.00
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTGACATTGCATCTGGATTC -3'
(R):5'- AGCAGTGGATCGAAACCATCAG -3'

Sequencing Primer
(F):5'- GGATTCCTGTAAGGTCCACAC -3'
(R):5'- GTGGATCGAAACCATCAGCTCAG -3'
Posted On2015-11-11