Incidental Mutation 'R0321:Wwc1'
ID 35874
Institutional Source Beutler Lab
Gene Symbol Wwc1
Ensembl Gene ENSMUSG00000018849
Gene Name WW, C2 and coiled-coil domain containing 1
Synonyms Kibra
MMRRC Submission 038531-MU
Accession Numbers

NCBI RefSeq: NM_170779.1; MGI: 2388637

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0321 (G1)
Quality Score 123
Status Validated
Chromosome 11
Chromosomal Location 35838400-35980527 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 35841810 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1024 (Q1024*)
Ref Sequence ENSEMBL: ENSMUSP00000018993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018993]
AlphaFold Q5SXA9
Predicted Effect probably null
Transcript: ENSMUST00000018993
AA Change: Q1024*
SMART Domains Protein: ENSMUSP00000018993
Gene: ENSMUSG00000018849
AA Change: Q1024*

DomainStartEndE-ValueType
WW 7 39 7.96e-12 SMART
WW 54 86 5.22e-7 SMART
coiled coil region 107 133 N/A INTRINSIC
low complexity region 139 153 N/A INTRINSIC
coiled coil region 158 193 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
coiled coil region 294 330 N/A INTRINSIC
low complexity region 341 353 N/A INTRINSIC
coiled coil region 360 431 N/A INTRINSIC
low complexity region 527 549 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
Pfam:C2 674 784 8.3e-7 PFAM
low complexity region 842 860 N/A INTRINSIC
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype Strain: 5301655
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adult synaptic plasticity and fear-based conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Wwc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Wwc1 APN 11 35844202 missense possibly damaging 0.82
IGL01161:Wwc1 APN 11 35867276 missense probably damaging 1.00
IGL01401:Wwc1 APN 11 35898618 critical splice donor site probably null
IGL01771:Wwc1 APN 11 35853358 critical splice donor site probably null
IGL01804:Wwc1 APN 11 35841924 missense probably damaging 1.00
IGL02079:Wwc1 APN 11 35876058 missense probably damaging 1.00
IGL02201:Wwc1 APN 11 35844151 splice site probably benign
IGL03376:Wwc1 APN 11 35852294 missense possibly damaging 0.80
IGL03403:Wwc1 APN 11 35915284 missense possibly damaging 0.94
BB002:Wwc1 UTSW 11 35844163 missense probably benign 0.00
BB012:Wwc1 UTSW 11 35844163 missense probably benign 0.00
P0008:Wwc1 UTSW 11 35853351 splice site probably benign
R0277:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0323:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0629:Wwc1 UTSW 11 35853472 missense probably benign 0.18
R1302:Wwc1 UTSW 11 35844157 missense probably damaging 1.00
R1769:Wwc1 UTSW 11 35861844 missense probably benign
R1870:Wwc1 UTSW 11 35861945 missense probably damaging 1.00
R2000:Wwc1 UTSW 11 35876547 missense probably damaging 1.00
R2074:Wwc1 UTSW 11 35889353 missense possibly damaging 0.62
R2138:Wwc1 UTSW 11 35841887 missense possibly damaging 0.47
R2140:Wwc1 UTSW 11 35870528 missense probably benign 0.01
R2680:Wwc1 UTSW 11 35875929 missense probably benign 0.23
R3864:Wwc1 UTSW 11 35910316 missense probably damaging 1.00
R4773:Wwc1 UTSW 11 35867296 missense probably benign
R4926:Wwc1 UTSW 11 35889400 missense probably benign 0.17
R4980:Wwc1 UTSW 11 35888103 missense possibly damaging 0.93
R4990:Wwc1 UTSW 11 35876566 missense probably benign 0.00
R5044:Wwc1 UTSW 11 35883345 missense probably benign 0.45
R5238:Wwc1 UTSW 11 35875896 missense probably benign 0.02
R5421:Wwc1 UTSW 11 35876063 missense possibly damaging 0.81
R5421:Wwc1 UTSW 11 35910296 missense possibly damaging 0.93
R5461:Wwc1 UTSW 11 35867372 missense probably damaging 1.00
R5705:Wwc1 UTSW 11 35876596 missense probably damaging 0.99
R5847:Wwc1 UTSW 11 35867326 missense probably damaging 1.00
R5993:Wwc1 UTSW 11 35852336 missense probably benign 0.17
R6006:Wwc1 UTSW 11 35870982 missense probably null 1.00
R6006:Wwc1 UTSW 11 35889273 missense probably damaging 0.98
R6516:Wwc1 UTSW 11 35867302 missense probably benign 0.05
R6519:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6520:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6525:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6526:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6527:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6528:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R7060:Wwc1 UTSW 11 35915176 missense possibly damaging 0.74
R7156:Wwc1 UTSW 11 35897374 critical splice donor site probably null
R7448:Wwc1 UTSW 11 35875706 missense probably benign
R7586:Wwc1 UTSW 11 35844195 missense possibly damaging 0.69
R7793:Wwc1 UTSW 11 35869109 missense probably benign 0.21
R7925:Wwc1 UTSW 11 35844163 missense probably benign 0.00
R8296:Wwc1 UTSW 11 35870557 splice site probably benign
R8369:Wwc1 UTSW 11 35867371 missense probably damaging 1.00
R8735:Wwc1 UTSW 11 35883407 missense probably damaging 1.00
R8804:Wwc1 UTSW 11 35883317 missense probably benign 0.30
R9081:Wwc1 UTSW 11 35891504 missense probably benign 0.12
R9281:Wwc1 UTSW 11 35889384 missense probably benign 0.03
R9561:Wwc1 UTSW 11 35979969 critical splice donor site probably null
R9619:Wwc1 UTSW 11 35875952 missense probably damaging 0.98
R9713:Wwc1 UTSW 11 35875749 missense probably benign 0.33
X0025:Wwc1 UTSW 11 35876040 missense possibly damaging 0.95
Z1088:Wwc1 UTSW 11 35883482 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGACAGGACAGGGTTTCAGTCTAGC -3'
(R):5'- GGCAGGCATGAACATCATCTCCAC -3'

Sequencing Primer
(F):5'- GCTGTATCTGATGAAGGACTCAC -3'
(R):5'- GAACATCATCTCCACCCCCG -3'
Posted On 2013-05-09