Incidental Mutation 'R4730:Hs3st1'
ID358746
Institutional Source Beutler Lab
Gene Symbol Hs3st1
Ensembl Gene ENSMUSG00000051022
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 1
SynonymsD5Wsu110e, 3-OST
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location39613935-39755475 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 39614805 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 165 (L165*)
Ref Sequence ENSEMBL: ENSMUSP00000114997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053116] [ENSMUST00000117944] [ENSMUST00000137142] [ENSMUST00000152057]
Predicted Effect probably null
Transcript: ENSMUST00000053116
AA Change: L165*
SMART Domains Protein: ENSMUSP00000051055
Gene: ENSMUSG00000051022
AA Change: L165*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117944
AA Change: L165*
SMART Domains Protein: ENSMUSP00000113919
Gene: ENSMUSG00000051022
AA Change: L165*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137142
AA Change: L165*
SMART Domains Protein: ENSMUSP00000114997
Gene: ENSMUSG00000051022
AA Change: L165*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 177 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152057
SMART Domains Protein: ENSMUSP00000118060
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1fmja_ 25 74 1e-5 SMART
PDB:1VKJ|C 40 75 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200697
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It possesses both heparan sulfate glucosaminyl 3-O-sulfotransferase activity, anticoagulant heparan sulfate conversion activity, and is a rate limiting enzyme for synthesis of anticoagulant heparan. This enzyme is an intraluminal Golgi resident protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth retardation and death between postnatal days 2-3 when bred on a C57BL/6J background. Mice homozygous for this mutation on a 129 background are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Hs3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Hs3st1 APN 5 39614757 missense probably damaging 1.00
IGL03162:Hs3st1 APN 5 39614449 nonsense probably null
R1105:Hs3st1 UTSW 5 39614698 unclassified probably benign
R1539:Hs3st1 UTSW 5 39614448 missense probably benign
R1577:Hs3st1 UTSW 5 39615050 missense probably benign 0.01
R3857:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R3858:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R6091:Hs3st1 UTSW 5 39614664 missense probably damaging 1.00
R6194:Hs3st1 UTSW 5 39614405 missense probably damaging 0.96
R6213:Hs3st1 UTSW 5 39614521 missense probably damaging 1.00
R6292:Hs3st1 UTSW 5 39614790 missense possibly damaging 0.69
R7453:Hs3st1 UTSW 5 39614967 missense probably damaging 1.00
R8276:Hs3st1 UTSW 5 39614803 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAAGGGTCTCTGATGAGGC -3'
(R):5'- TCTTTGACTGGGAGGAGCATTAC -3'

Sequencing Primer
(F):5'- CGGTCGCCATCCACAATGTG -3'
(R):5'- GAGCATTACAGCCAAGGCCTG -3'
Posted On2015-11-11