Incidental Mutation 'R4730:Sytl2'
ID358759
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 90381249 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837] [ENSMUST00000208720]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098310
SMART Domains Protein: ENSMUSP00000095912
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
low complexity region 938 966 N/A INTRINSIC
C2 990 1095 4.59e-15 SMART
C2 1139 1242 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107210
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107211
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190365
Predicted Effect probably benign
Transcript: ENSMUST00000190731
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190837
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207629
Predicted Effect probably benign
Transcript: ENSMUST00000208720
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0269:Sytl2 UTSW 7 90403020 splice site probably benign
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R3952:Sytl2 UTSW 7 90381492 intron probably benign
R4082:Sytl2 UTSW 7 90408427 missense possibly damaging 0.88
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5096:Sytl2 UTSW 7 90376082 missense possibly damaging 0.49
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R5792:Sytl2 UTSW 7 90375689 missense probably damaging 0.98
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAAGGAGTTTAACGCCATG -3'
(R):5'- AGTGCTTGCTGTTCATGAACTTC -3'

Sequencing Primer
(F):5'- AGGAGTTTAACGCCATGAAATTATC -3'
(R):5'- GTTCATGAACTTCCTTGCCAGAAG -3'
Posted On2015-11-11