Incidental Mutation 'R4730:Hmg20a'
ID358769
Institutional Source Beutler Lab
Gene Symbol Hmg20a
Ensembl Gene ENSMUSG00000032329
Gene Namehigh mobility group 20A
SynonymsHmgxb1, 5730490E10Rik, 1200004E06Rik
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56418609-56496936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56467419 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 20 (S20T)
Ref Sequence ENSEMBL: ENSMUSP00000149375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034879] [ENSMUST00000213242] [ENSMUST00000214771] [ENSMUST00000214869] [ENSMUST00000215269] [ENSMUST00000217518]
Predicted Effect probably benign
Transcript: ENSMUST00000034879
AA Change: S20T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034879
Gene: ENSMUSG00000032329
AA Change: S20T

DomainStartEndE-ValueType
low complexity region 80 94 N/A INTRINSIC
HMG 101 171 1.86e-21 SMART
coiled coil region 228 272 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213242
AA Change: S20T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214771
AA Change: S20T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000214869
AA Change: S20T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000215269
AA Change: S20T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217518
AA Change: S20T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Hmg20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Hmg20a APN 9 56487650 missense probably damaging 1.00
IGL01981:Hmg20a APN 9 56477230 missense probably damaging 1.00
IGL02085:Hmg20a APN 9 56477302 nonsense probably null
IGL03284:Hmg20a APN 9 56481617 missense probably benign 0.25
ANU22:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
P0033:Hmg20a UTSW 9 56489824 missense probably benign 0.01
R0369:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
R0710:Hmg20a UTSW 9 56474670 missense possibly damaging 0.84
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1546:Hmg20a UTSW 9 56467401 missense possibly damaging 0.56
R2188:Hmg20a UTSW 9 56477300 missense possibly damaging 0.93
R4956:Hmg20a UTSW 9 56481664 missense probably damaging 1.00
R6115:Hmg20a UTSW 9 56489832 missense possibly damaging 0.95
R6130:Hmg20a UTSW 9 56488607 splice site probably null
R6152:Hmg20a UTSW 9 56481608 missense probably damaging 1.00
R6961:Hmg20a UTSW 9 56488728 missense probably benign 0.29
R7499:Hmg20a UTSW 9 56488943 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGAAAACAGACATTTAGGTCAG -3'
(R):5'- TCAATTTACAGGGACCGGACTG -3'

Sequencing Primer
(F):5'- ACAGACATTTAGGTCAGTTTCTATTC -3'
(R):5'- GACCGGACTGCAGCCAAAAG -3'
Posted On2015-11-11