Incidental Mutation 'R4730:Olfr820'
ID358775
Institutional Source Beutler Lab
Gene Symbol Olfr820
Ensembl Gene ENSMUSG00000048745
Gene Nameolfactory receptor 820
SynonymsGA_x6K02T2PULF-11688441-11689379, MOR116-1
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130012621-130021286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130017547 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 62 (R62Q)
Ref Sequence ENSEMBL: ENSMUSP00000150332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059244] [ENSMUST00000214917] [ENSMUST00000215791]
Predicted Effect probably damaging
Transcript: ENSMUST00000059244
AA Change: R62Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052995
Gene: ENSMUSG00000048745
AA Change: R62Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-47 PFAM
Pfam:7tm_1 39 288 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214917
AA Change: R62Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215791
AA Change: R62Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Olfr820
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Olfr820 APN 10 130017841 missense probably damaging 0.98
IGL01938:Olfr820 APN 10 130018112 nonsense probably null
IGL02369:Olfr820 APN 10 130017556 missense possibly damaging 0.81
R0378:Olfr820 UTSW 10 130018003 missense probably damaging 1.00
R0437:Olfr820 UTSW 10 130018096 missense probably damaging 1.00
R0648:Olfr820 UTSW 10 130017481 missense probably damaging 1.00
R1891:Olfr820 UTSW 10 130017570 missense probably damaging 1.00
R2187:Olfr820 UTSW 10 130017688 missense probably damaging 1.00
R4190:Olfr820 UTSW 10 130017978 missense probably damaging 0.96
R6380:Olfr820 UTSW 10 130017913 missense probably benign 0.18
R6496:Olfr820 UTSW 10 130017579 missense probably benign 0.13
R7198:Olfr820 UTSW 10 130017891 missense probably damaging 1.00
R7667:Olfr820 UTSW 10 130017534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGAAGTTAAAGATGGCAAACC -3'
(R):5'- CTCATGATAGTTGTGTAATGCAGG -3'

Sequencing Primer
(F):5'- CAACCTTCAAGCTGTGCT -3'
(R):5'- AACATAGCGGTCATAGGACATCACTG -3'
Posted On2015-11-11