Incidental Mutation 'R0321:Akr1c18'
ID35879
Institutional Source Beutler Lab
Gene Symbol Akr1c18
Ensembl Gene ENSMUSG00000021214
Gene Namealdo-keto reductase family 1, member C18
Synonyms20alpha-HSD, 20alpha-hydroxysteroid dehydrogenase
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0321 (G1)
Quality Score150
Status Validated
Chromosome13
Chromosomal Location4132615-4150654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4135244 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 296 (L296F)
Ref Sequence ENSEMBL: ENSMUSP00000021635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021635] [ENSMUST00000110704]
Predicted Effect probably damaging
Transcript: ENSMUST00000021635
AA Change: L296F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021635
Gene: ENSMUSG00000021214
AA Change: L296F

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 4.2e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110704
AA Change: L270F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106332
Gene: ENSMUSG00000021214
AA Change: L270F

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 275 1.1e-50 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display prolonged pregnancies and decreased number of pups. Some cannot induce parturition while others are able to give birth but show a prolonged estrous cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Akr1c18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Akr1c18 APN 13 4137233 missense probably damaging 1.00
IGL01458:Akr1c18 APN 13 4137144 missense probably damaging 1.00
R0514:Akr1c18 UTSW 13 4137191 missense probably benign 0.00
R0653:Akr1c18 UTSW 13 4145308 missense probably damaging 1.00
R1006:Akr1c18 UTSW 13 4136655 missense probably benign 0.00
R1345:Akr1c18 UTSW 13 4145214 missense possibly damaging 0.94
R1656:Akr1c18 UTSW 13 4145253 missense probably benign 0.12
R1887:Akr1c18 UTSW 13 4143288 missense probably benign 0.02
R2015:Akr1c18 UTSW 13 4145309 missense probably damaging 1.00
R2570:Akr1c18 UTSW 13 4142164 missense probably benign 0.04
R3951:Akr1c18 UTSW 13 4135285 missense probably benign 0.06
R4717:Akr1c18 UTSW 13 4136718 missense probably benign 0.00
R5414:Akr1c18 UTSW 13 4136735 missense probably damaging 1.00
R5540:Akr1c18 UTSW 13 4137179 missense probably benign 0.22
R5723:Akr1c18 UTSW 13 4144329 nonsense probably null
R6797:Akr1c18 UTSW 13 4145277 missense probably benign 0.02
R7343:Akr1c18 UTSW 13 4137237 missense probably damaging 0.99
R7741:Akr1c18 UTSW 13 4144333 missense possibly damaging 0.90
R8181:Akr1c18 UTSW 13 4135263 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCGTGCTTAAGAGCAAAACTCTG -3'
(R):5'- AAGCCAGTTTCTGAGTCCTTTGACC -3'

Sequencing Primer
(F):5'- GAAAGAGCATTCTACAAATCTGTGTC -3'
(R):5'- CTGAGTCCTTTGACCAGGAATG -3'
Posted On2013-05-09