Incidental Mutation 'R0321:Vps41'
ID35880
Institutional Source Beutler Lab
Gene Symbol Vps41
Ensembl Gene ENSMUSG00000041236
Gene NameVPS41 HOPS complex subunit
SynonymsVam2, mVam2
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0321 (G1)
Quality Score216
Status Validated
Chromosome13
Chromosomal Location18717286-18866811 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 18842295 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072961]
Predicted Effect probably benign
Transcript: ENSMUST00000072961
SMART Domains Protein: ENSMUSP00000072729
Gene: ENSMUSG00000041236

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Blast:WD40 34 70 2e-7 BLAST
SCOP:d1flga_ 44 253 6e-9 SMART
Blast:WD40 159 195 3e-11 BLAST
CLH 570 711 1.92e-42 SMART
RING 790 837 8.98e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222102
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die by E9 exhibiting morphological and functional alteration of late endocytic compartments, and abnormal triploblastic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Vps41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Vps41 APN 13 18866150 missense probably benign 0.37
IGL01563:Vps41 APN 13 18782727 splice site probably benign
IGL01880:Vps41 APN 13 18810471 missense probably benign 0.01
IGL02024:Vps41 APN 13 18791657 splice site probably benign
IGL02458:Vps41 APN 13 18853479 missense possibly damaging 0.67
IGL02740:Vps41 APN 13 18838680 missense probably damaging 1.00
IGL03218:Vps41 APN 13 18829270 missense possibly damaging 0.74
R0197:Vps41 UTSW 13 18854663 critical splice donor site probably null
R0284:Vps41 UTSW 13 18853440 missense probably damaging 1.00
R0372:Vps41 UTSW 13 18842247 missense probably benign 0.00
R0382:Vps41 UTSW 13 18827727 missense probably benign 0.30
R1691:Vps41 UTSW 13 18841243 missense probably damaging 1.00
R2055:Vps41 UTSW 13 18854616 missense possibly damaging 0.95
R2082:Vps41 UTSW 13 18852351 missense probably benign 0.27
R2147:Vps41 UTSW 13 18839734 splice site probably null
R2897:Vps41 UTSW 13 18810428 splice site probably benign
R4322:Vps41 UTSW 13 18823790 missense probably damaging 1.00
R4600:Vps41 UTSW 13 18745283 missense probably damaging 0.97
R4751:Vps41 UTSW 13 18811622 missense probably damaging 0.98
R4856:Vps41 UTSW 13 18829255 missense probably damaging 0.98
R5389:Vps41 UTSW 13 18862538 missense probably damaging 0.99
R7022:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R7456:Vps41 UTSW 13 18864034 missense probably benign 0.02
R7747:Vps41 UTSW 13 18841252 critical splice donor site probably null
R7790:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R8029:Vps41 UTSW 13 18823785 nonsense probably null
R8033:Vps41 UTSW 13 18810465 missense possibly damaging 0.94
R8241:Vps41 UTSW 13 18848998 missense possibly damaging 0.73
R8267:Vps41 UTSW 13 18810471 missense probably benign 0.00
R8801:Vps41 UTSW 13 18814233 missense possibly damaging 0.78
Z1177:Vps41 UTSW 13 18845935 missense probably benign 0.00
Z1177:Vps41 UTSW 13 18854595 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCACTATCCTTTAATGGCCTGCAC -3'
(R):5'- TGCTGAGCCCTAACTTTCAAGTCTG -3'

Sequencing Primer
(F):5'- CAGTACCACCCTATGAAGAGTG -3'
(R):5'- AACCTGTCTCACTGGGAAAG -3'
Posted On2013-05-09