Incidental Mutation 'R4731:Iho1'
ID 358849
Institutional Source Beutler Lab
Gene Symbol Iho1
Ensembl Gene ENSMUSG00000047220
Gene Name interactor of HORMAD1 1
Synonyms Ccdc36, Iho1
MMRRC Submission 042021-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R4731 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108280810-108305683 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108282584 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 368 (V368A)
Ref Sequence ENSEMBL: ENSMUSP00000075898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076592] [ENSMUST00000192995]
AlphaFold Q6PDM4
Predicted Effect probably benign
Transcript: ENSMUST00000076592
AA Change: V368A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075898
Gene: ENSMUSG00000047220
AA Change: V368A

DomainStartEndE-ValueType
Pfam:DUF4700 19 572 4.7e-274 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192995
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (117/118)
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actmap T A 7: 26,900,468 (GRCm39) M149K probably damaging Het
Adamts12 A T 15: 11,270,748 (GRCm39) S668C probably damaging Het
Adcy8 A G 15: 64,626,711 (GRCm39) V709A possibly damaging Het
Aim2 T A 1: 173,291,442 (GRCm39) D282E possibly damaging Het
Akap9 T A 5: 4,012,266 (GRCm39) S990T possibly damaging Het
Aloxe3 A T 11: 69,019,480 (GRCm39) D131V probably null Het
Ankrd28 A C 14: 31,477,698 (GRCm39) C115G probably benign Het
Anxa2 A T 9: 69,393,812 (GRCm39) M217L probably benign Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Btaf1 A G 19: 36,958,478 (GRCm39) D665G probably benign Het
Cdc42bpg T A 19: 6,361,221 (GRCm39) V282E probably damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cdipt T A 7: 126,577,530 (GRCm39) L92H probably damaging Het
Cep104 T A 4: 154,072,883 (GRCm39) D380E probably damaging Het
Cfap74 T A 4: 155,548,059 (GRCm39) probably benign Het
Chd1 A T 17: 17,598,079 (GRCm39) E55D probably benign Het
Cldnd2 T A 7: 43,091,613 (GRCm39) C65S possibly damaging Het
Clec9a G T 6: 129,393,299 (GRCm39) A108S probably benign Het
Cog7 T C 7: 121,563,467 (GRCm39) D215G probably benign Het
Col9a3 G A 2: 180,252,474 (GRCm39) E373K probably damaging Het
Deptor C A 15: 55,044,406 (GRCm39) H191N probably benign Het
Dgkz A T 2: 91,768,684 (GRCm39) I699N probably damaging Het
Dnah7c T A 1: 46,809,333 (GRCm39) N3550K probably damaging Het
Dnah8 A G 17: 30,994,035 (GRCm39) K3384R probably null Het
Dnajc13 CT C 9: 104,064,004 (GRCm39) probably benign Het
Dnhd1 C A 7: 105,323,056 (GRCm39) N521K probably benign Het
Efhb G A 17: 53,733,272 (GRCm39) T533I probably damaging Het
Ercc4 A T 16: 12,965,471 (GRCm39) H701L probably damaging Het
Ern1 A T 11: 106,325,676 (GRCm39) probably benign Het
Etfb T C 7: 43,093,624 (GRCm39) V17A probably damaging Het
Evc T A 5: 37,481,141 (GRCm39) M235L probably benign Het
Fbxw22 T C 9: 109,207,937 (GRCm39) I445V probably benign Het
Fmnl2 A G 2: 53,007,081 (GRCm39) T764A possibly damaging Het
Fto T A 8: 92,136,342 (GRCm39) D205E probably damaging Het
Galntl6 G A 8: 58,880,847 (GRCm39) P147L probably damaging Het
Gm6871 T C 7: 41,196,173 (GRCm39) I39V probably benign Het
Gpr83 A G 9: 14,777,470 (GRCm39) probably benign Het
Gucy1a2 A T 9: 3,759,424 (GRCm39) H410L probably benign Het
Helb T C 10: 119,930,193 (GRCm39) probably null Het
Ifi214 T C 1: 173,354,157 (GRCm39) Q171R probably benign Het
Ifit1bl1 T C 19: 34,571,721 (GRCm39) I245M probably benign Het
Igdcc3 A G 9: 65,089,279 (GRCm39) T492A probably damaging Het
Ighv13-1 T C 12: 114,231,252 (GRCm39) probably benign Het
Igkv4-50 T C 6: 69,677,984 (GRCm39) K40R probably benign Het
Igkv8-18 T A 6: 70,333,280 (GRCm39) I74N probably damaging Het
Kbtbd7 T C 14: 79,666,240 (GRCm39) *691Q probably null Het
Khnyn T A 14: 56,123,946 (GRCm39) probably null Het
Kif26a G A 12: 112,142,007 (GRCm39) A754T probably benign Het
Llgl1 T A 11: 60,597,051 (GRCm39) L194* probably null Het
Map3k12 G T 15: 102,409,717 (GRCm39) T686N probably benign Het
Myo18a C A 11: 77,720,585 (GRCm39) P741Q probably benign Het
Ncaph2 G A 15: 89,240,030 (GRCm39) probably benign Het
Nfkb2 A G 19: 46,297,403 (GRCm39) Q406R possibly damaging Het
Or10g9b A T 9: 39,917,564 (GRCm39) I227N probably damaging Het
Or11g2 T A 14: 50,856,026 (GRCm39) C116S probably benign Het
Or1ad6 G A 11: 50,860,093 (GRCm39) V83M possibly damaging Het
Or2i1 T C 17: 37,507,915 (GRCm39) T315A probably damaging Het
Or2n1e T A 17: 38,586,438 (GRCm39) Y259N probably damaging Het
Or8b12 A T 9: 37,657,831 (GRCm39) T134S probably benign Het
Ostm1 C T 10: 42,554,975 (GRCm39) probably benign Het
Pabpc1 A T 15: 36,599,528 (GRCm39) V389E probably benign Het
Pank4 A T 4: 155,055,847 (GRCm39) M291L probably benign Het
Pex6 A G 17: 47,033,214 (GRCm39) D579G probably benign Het
Pex6 A G 17: 47,035,633 (GRCm39) probably null Het
Phc2 C T 4: 128,601,764 (GRCm39) T73M probably damaging Het
Pkp4 G A 2: 59,165,276 (GRCm39) probably null Het
Plekhg1 T A 10: 3,907,506 (GRCm39) S808T probably benign Het
Plk5 A T 10: 80,194,631 (GRCm39) H118L probably damaging Het
Pnlip T C 19: 58,664,919 (GRCm39) I249T probably benign Het
Ptov1 T C 7: 44,516,533 (GRCm39) D134G probably benign Het
Ptprb T C 10: 116,155,238 (GRCm39) V664A probably benign Het
Ptprz1 T A 6: 23,002,609 (GRCm39) S1566R probably benign Het
Pum1 T C 4: 130,445,504 (GRCm39) S158P probably benign Het
Rae1 G T 2: 172,857,185 (GRCm39) probably benign Het
Ros1 A C 10: 52,018,325 (GRCm39) W778G probably damaging Het
Ryr2 A T 13: 11,592,795 (GRCm39) M4653K possibly damaging Het
Sacm1l G A 9: 123,419,895 (GRCm39) V553I probably benign Het
Samd4b G A 7: 28,106,088 (GRCm39) R377W probably benign Het
Selenoo A G 15: 88,983,531 (GRCm39) Q524R probably benign Het
Slc30a3 T C 5: 31,250,638 (GRCm39) S22G probably benign Het
Slc35g2 A C 9: 100,434,555 (GRCm39) V372G probably benign Het
Slc5a8 T C 10: 88,761,649 (GRCm39) probably null Het
Slc7a7 T C 14: 54,646,190 (GRCm39) Y91C probably damaging Het
Slc7a9 T A 7: 35,152,988 (GRCm39) Y135* probably null Het
Slfn1 A T 11: 83,012,661 (GRCm39) E259V probably damaging Het
Slmap T C 14: 26,189,690 (GRCm39) N156S probably damaging Het
Smim29 A G 17: 27,784,244 (GRCm39) probably benign Het
Sorbs1 T A 19: 40,303,133 (GRCm39) R485S probably benign Het
Sptbn2 T A 19: 4,792,508 (GRCm39) F1388I probably damaging Het
Stac2 C T 11: 97,930,521 (GRCm39) G349E probably damaging Het
Tigd2 T A 6: 59,188,400 (GRCm39) H422Q probably benign Het
Tle1 T C 4: 72,043,256 (GRCm39) N538D possibly damaging Het
Tmtc1 A C 6: 148,186,478 (GRCm39) probably null Het
Tns3 C T 11: 8,400,986 (GRCm39) R1104H probably benign Het
Tom1l2 C G 11: 60,161,259 (GRCm39) R84P probably damaging Het
Trank1 T C 9: 111,219,478 (GRCm39) F2072L probably damaging Het
Trim6 T C 7: 103,881,855 (GRCm39) Y369H probably damaging Het
Trpc7 A G 13: 56,952,366 (GRCm39) S541P probably damaging Het
Trpv4 T C 5: 114,760,814 (GRCm39) D732G possibly damaging Het
Tsc2 C A 17: 24,822,249 (GRCm39) V1141F possibly damaging Het
Tspoap1 T A 11: 87,656,473 (GRCm39) V257E probably benign Het
Ttn A T 2: 76,773,355 (GRCm39) M2395K unknown Het
Ubd A C 17: 37,506,593 (GRCm39) T160P probably benign Het
Ubr7 A G 12: 102,735,485 (GRCm39) T315A probably benign Het
Ugt2b36 G T 5: 87,229,397 (GRCm39) Y156* probably null Het
Ulk4 G A 9: 121,092,704 (GRCm39) R178* probably null Het
Urod G A 4: 116,848,870 (GRCm39) A92V possibly damaging Het
Utp20 T C 10: 88,590,382 (GRCm39) D2364G possibly damaging Het
Vmn1r87 A T 7: 12,866,254 (GRCm39) M11K possibly damaging Het
Vstm4 A G 14: 32,639,859 (GRCm39) K96E possibly damaging Het
Wwp1 T C 4: 19,661,990 (GRCm39) D172G probably benign Het
Zfhx3 A G 8: 109,682,716 (GRCm39) Q3385R unknown Het
Zfp229 C T 17: 21,964,267 (GRCm39) H166Y possibly damaging Het
Zfp738 A T 13: 67,818,033 (GRCm39) C653S probably damaging Het
Zp2 C A 7: 119,737,343 (GRCm39) V282L probably damaging Het
Other mutations in Iho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Iho1 APN 9 108,294,518 (GRCm39) splice site probably benign
IGL02138:Iho1 APN 9 108,283,820 (GRCm39) missense probably benign 0.00
IGL02305:Iho1 APN 9 108,283,031 (GRCm39) missense possibly damaging 0.82
IGL02456:Iho1 APN 9 108,283,820 (GRCm39) missense probably benign 0.00
IGL02936:Iho1 APN 9 108,289,702 (GRCm39) missense possibly damaging 0.69
IGL03150:Iho1 APN 9 108,282,155 (GRCm39) missense probably damaging 0.98
IGL03163:Iho1 APN 9 108,282,132 (GRCm39) missense probably benign 0.00
IGL03280:Iho1 APN 9 108,282,099 (GRCm39) missense possibly damaging 0.92
R0139:Iho1 UTSW 9 108,289,695 (GRCm39) missense probably damaging 1.00
R0276:Iho1 UTSW 9 108,305,639 (GRCm39) missense possibly damaging 0.84
R0744:Iho1 UTSW 9 108,282,000 (GRCm39) missense probably benign
R0836:Iho1 UTSW 9 108,282,000 (GRCm39) missense probably benign
R1792:Iho1 UTSW 9 108,282,111 (GRCm39) missense possibly damaging 0.84
R1918:Iho1 UTSW 9 108,290,184 (GRCm39) missense probably benign 0.16
R2284:Iho1 UTSW 9 108,298,672 (GRCm39) missense probably damaging 1.00
R2401:Iho1 UTSW 9 108,290,205 (GRCm39) missense possibly damaging 0.53
R4819:Iho1 UTSW 9 108,283,877 (GRCm39) missense probably benign 0.10
R4950:Iho1 UTSW 9 108,298,709 (GRCm39) missense probably damaging 1.00
R4968:Iho1 UTSW 9 108,289,713 (GRCm39) missense probably benign 0.11
R7131:Iho1 UTSW 9 108,294,619 (GRCm39) missense probably benign 0.01
R7201:Iho1 UTSW 9 108,281,974 (GRCm39) missense probably damaging 0.98
R7950:Iho1 UTSW 9 108,282,870 (GRCm39) missense probably benign
R8778:Iho1 UTSW 9 108,282,807 (GRCm39) missense probably damaging 0.97
R9316:Iho1 UTSW 9 108,298,726 (GRCm39) missense possibly damaging 0.60
R9501:Iho1 UTSW 9 108,282,500 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCGGTTGCTGACTGTTCAAG -3'
(R):5'- GGAAAAGCATCCCTCTGAGGAG -3'

Sequencing Primer
(F):5'- CTGACTGTTCAAGTGAGTCAAAAG -3'
(R):5'- TGCAGGAAATCCCAGTACGAGTTC -3'
Posted On 2015-11-11